Incidental Mutation 'R0555:Sltm'
ID 45489
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene Name SAFB-like, transcription modulator
Synonyms 5730455C01Rik, 5730555F13Rik, 9130215G10Rik
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R0555 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 70450036-70499516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70493363 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 769 (F769L)
Ref Sequence ENSEMBL: ENSMUSP00000149059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
AlphaFold Q8CH25
Predicted Effect probably damaging
Transcript: ENSMUST00000049263
AA Change: F787L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: F787L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: F769L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216881
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70,486,624 (GRCm39) missense probably damaging 1.00
IGL01755:Sltm APN 9 70,491,204 (GRCm39) splice site probably null
IGL01782:Sltm APN 9 70,480,923 (GRCm39) missense probably damaging 1.00
IGL02441:Sltm APN 9 70,494,467 (GRCm39) missense probably damaging 1.00
IGL02831:Sltm APN 9 70,492,147 (GRCm39) missense probably damaging 1.00
IGL02947:Sltm APN 9 70,498,946 (GRCm39) missense probably benign 0.05
IGL03166:Sltm APN 9 70,450,251 (GRCm39) missense possibly damaging 0.87
R0288:Sltm UTSW 9 70,486,633 (GRCm39) missense probably damaging 1.00
R0815:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R0863:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R1315:Sltm UTSW 9 70,450,347 (GRCm39) missense probably benign 0.13
R1533:Sltm UTSW 9 70,493,948 (GRCm39) missense probably damaging 1.00
R1676:Sltm UTSW 9 70,480,929 (GRCm39) missense probably damaging 1.00
R1764:Sltm UTSW 9 70,469,082 (GRCm39) missense probably benign 0.00
R1845:Sltm UTSW 9 70,450,314 (GRCm39) missense possibly damaging 0.60
R2049:Sltm UTSW 9 70,488,583 (GRCm39) missense probably benign 0.00
R2163:Sltm UTSW 9 70,498,964 (GRCm39) missense probably damaging 0.99
R3410:Sltm UTSW 9 70,493,240 (GRCm39) missense probably damaging 0.97
R4323:Sltm UTSW 9 70,487,529 (GRCm39) missense probably benign
R4632:Sltm UTSW 9 70,486,651 (GRCm39) missense possibly damaging 0.86
R4748:Sltm UTSW 9 70,488,647 (GRCm39) missense probably damaging 1.00
R4756:Sltm UTSW 9 70,498,892 (GRCm39) missense possibly damaging 0.57
R4782:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4799:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4887:Sltm UTSW 9 70,496,260 (GRCm39) missense probably damaging 1.00
R5221:Sltm UTSW 9 70,486,685 (GRCm39) missense probably damaging 1.00
R5263:Sltm UTSW 9 70,492,081 (GRCm39) missense unknown
R5982:Sltm UTSW 9 70,494,086 (GRCm39) missense probably damaging 1.00
R6297:Sltm UTSW 9 70,488,641 (GRCm39) missense probably damaging 0.99
R6456:Sltm UTSW 9 70,450,269 (GRCm39) missense probably damaging 1.00
R6658:Sltm UTSW 9 70,488,644 (GRCm39) missense probably damaging 1.00
R6720:Sltm UTSW 9 70,480,992 (GRCm39) missense probably damaging 1.00
R6770:Sltm UTSW 9 70,492,059 (GRCm39) missense unknown
R6923:Sltm UTSW 9 70,481,892 (GRCm39) missense probably damaging 1.00
R7051:Sltm UTSW 9 70,466,348 (GRCm39) missense probably damaging 1.00
R7166:Sltm UTSW 9 70,492,132 (GRCm39) missense probably damaging 1.00
R7257:Sltm UTSW 9 70,451,247 (GRCm39) splice site probably null
R7400:Sltm UTSW 9 70,493,352 (GRCm39) missense probably damaging 1.00
R7438:Sltm UTSW 9 70,480,748 (GRCm39) missense unknown
R7484:Sltm UTSW 9 70,481,179 (GRCm39) missense unknown
R7630:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7631:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7632:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7633:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7862:Sltm UTSW 9 70,479,446 (GRCm39) nonsense probably null
R7885:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7886:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7888:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7889:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7891:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7915:Sltm UTSW 9 70,494,431 (GRCm39) missense probably damaging 1.00
R8030:Sltm UTSW 9 70,493,261 (GRCm39) nonsense probably null
R8062:Sltm UTSW 9 70,480,779 (GRCm39) missense unknown
R8099:Sltm UTSW 9 70,493,360 (GRCm39) missense probably damaging 1.00
R8374:Sltm UTSW 9 70,469,227 (GRCm39) missense probably null
R8698:Sltm UTSW 9 70,494,352 (GRCm39) missense probably benign 0.27
R9541:Sltm UTSW 9 70,481,057 (GRCm39) missense unknown
R9563:Sltm UTSW 9 70,480,841 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGCGAGATGACCCTTACTGGAG -3'
(R):5'- ACCAGCCTGCATGGTTTACTGTTAC -3'

Sequencing Primer
(F):5'- CCCTTACTGGAGCGAGAATAAAAAG -3'
(R):5'- actcctgactcttcagctcc -3'
Posted On 2013-06-11