Incidental Mutation 'R5856:Gm19965'
ID454892
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
MMRRC Submission 043230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5856 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116821849 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 420 (D420G)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect probably benign
Transcript: ENSMUST00000179777
AA Change: D420G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: D420G

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrf5 A G 17: 43,446,120 T497A probably benign Het
Ano5 T C 7: 51,585,326 I669T probably benign Het
Arhgap11a A T 2: 113,833,771 N722K possibly damaging Het
Atm A T 9: 53,495,955 I1161K possibly damaging Het
Atp13a4 T C 16: 29,433,987 T714A possibly damaging Het
BC051665 T A 13: 60,784,500 M92L probably benign Het
Car3 G A 3: 14,871,641 V255M probably damaging Het
Cnot11 C A 1: 39,537,453 F179L probably benign Het
Dctn1 A G 6: 83,197,865 Y1013C probably damaging Het
Gm5444 A G 13: 4,771,684 noncoding transcript Het
Hydin A T 8: 110,541,842 D2946V probably damaging Het
Hyou1 C T 9: 44,381,344 R119C probably damaging Het
Ighm A T 12: 113,421,602 L246Q unknown Het
Itpr3 A G 17: 27,106,405 E1324G probably damaging Het
Loxl4 G T 19: 42,595,366 Q749K possibly damaging Het
Muc2 C A 7: 141,745,644 probably benign Het
Myh11 T C 16: 14,205,976 T1505A probably benign Het
Nsmce2 A G 15: 59,378,943 E21G probably damaging Het
Olfr1220 T A 2: 89,097,910 I6F probably benign Het
Olfr273 T A 4: 52,856,516 probably benign Het
Plaa A G 4: 94,583,487 I375T probably benign Het
Pou2f1 C T 1: 165,915,130 A65T probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rxfp1 T A 3: 79,663,313 N271Y possibly damaging Het
Sema5b T G 16: 35,646,386 Y219* probably null Het
Slc35f3 G T 8: 126,321,080 R53L probably benign Het
Slc44a5 T C 3: 154,258,392 V465A possibly damaging Het
Slc9a5 A G 8: 105,357,165 I446V possibly damaging Het
Slf1 A T 13: 77,106,087 D204E possibly damaging Het
Sox5 T A 6: 144,209,362 T3S probably damaging Het
Srr G A 11: 74,913,012 R40C possibly damaging Het
Tas2r115 T A 6: 132,737,538 H150L possibly damaging Het
Tet2 A G 3: 133,486,640 S678P probably benign Het
Tmem11 T C 11: 60,864,858 K183E probably damaging Het
Upf1 T C 8: 70,334,762 probably null Het
Xpo6 A T 7: 126,149,502 probably benign Het
Zfp638 C T 6: 83,977,065 S1384L probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1335:Gm19965 UTSW 1 116804619 missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R2884:Gm19965 UTSW 1 116821583 missense probably benign 0.14
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6811:Gm19965 UTSW 1 116804079 missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense
R7162:Gm19965 UTSW 1 116822365 missense unknown
R7290:Gm19965 UTSW 1 116821191 missense
R7473:Gm19965 UTSW 1 116821872 missense unknown
R7643:Gm19965 UTSW 1 116822229 missense unknown
R7919:Gm19965 UTSW 1 116822120 nonsense probably null
R8187:Gm19965 UTSW 1 116821802 nonsense probably null
R8306:Gm19965 UTSW 1 116821785 missense
R8477:Gm19965 UTSW 1 116803124 start gained probably benign
R8751:Gm19965 UTSW 1 116822137 missense unknown
R8876:Gm19965 UTSW 1 116822046 missense unknown
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCAGTCTTCTTTGCAACAGC -3'
(R):5'- GTGGACTGTGTAAAAGATTTTCCAC -3'

Sequencing Primer
(F):5'- TTGCAACAGCAAACCATAGAG -3'
(R):5'- GGCAAACTTTAAGACTTGAGG -3'
Posted On2017-02-10