Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Gm19965'

454892

Institutional Source

Beutler Lab

Gene Symbol

Gm19965

Ensembl Gene

ENSMUSG00000094429

Gene Name

predicted gene, 19965

Synonyms

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116802983-116823410 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116821849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 420 (D420G)

Ref Sequence

ENSEMBL: ENSMUSP00000137019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179777]

AlphaFold

J3QNY8

Predicted Effect

probably benign
Transcript: ENSMUST00000179777
AA Change: D420G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: D420G

Domain	Start	End	E-Value	Type
KRAB	8	68	1.5e-36	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Gm19965

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0993:Gm19965	UTSW	1	116821825	missense	probably benign	0.04
R1016:Gm19965	UTSW	1	116821301	nonsense	probably null
R1173:Gm19965	UTSW	1	116820820	splice site	probably benign
R1175:Gm19965	UTSW	1	116820820	splice site	probably benign
R1335:Gm19965	UTSW	1	116804619	missense	possibly damaging	0.79
R1773:Gm19965	UTSW	1	116821259	nonsense	probably null
R1802:Gm19965	UTSW	1	116820903	nonsense	probably null
R2884:Gm19965	UTSW	1	116821583	missense	probably benign	0.14
R3435:Gm19965	UTSW	1	116821623	missense	possibly damaging	0.78
R4072:Gm19965	UTSW	1	116821071	missense	probably benign	0.17
R4585:Gm19965	UTSW	1	116821778	missense	probably benign	0.00
R4801:Gm19965	UTSW	1	116821896	missense	probably benign
R4802:Gm19965	UTSW	1	116821896	missense	probably benign
R5328:Gm19965	UTSW	1	116821418	missense	possibly damaging	0.78
R5960:Gm19965	UTSW	1	116821471	missense	possibly damaging	0.67
R6185:Gm19965	UTSW	1	116821273	missense	possibly damaging	0.61
R6297:Gm19965	UTSW	1	116822680	missense	possibly damaging	0.82
R6374:Gm19965	UTSW	1	116822291	missense	probably benign	0.06
R6811:Gm19965	UTSW	1	116804079	missense	probably damaging	1.00
R6860:Gm19965	UTSW	1	116820879	missense	probably benign	0.19
R7076:Gm19965	UTSW	1	116821275	missense
R7162:Gm19965	UTSW	1	116822365	missense	unknown
R7290:Gm19965	UTSW	1	116821191	missense
R7473:Gm19965	UTSW	1	116821872	missense	unknown
R7643:Gm19965	UTSW	1	116822229	missense	unknown
R7919:Gm19965	UTSW	1	116822120	nonsense	probably null
R8187:Gm19965	UTSW	1	116821802	nonsense	probably null
R8306:Gm19965	UTSW	1	116821785	missense
R8477:Gm19965	UTSW	1	116803124	start gained	probably benign
R8751:Gm19965	UTSW	1	116822137	missense	unknown
R8876:Gm19965	UTSW	1	116822046	missense	unknown
R9151:Gm19965	UTSW	1	116821212	missense
R9389:Gm19965	UTSW	1	116821836	missense
R9444:Gm19965	UTSW	1	116804663	missense
R9696:Gm19965	UTSW	1	116803108	start gained	probably benign
R9696:Gm19965	UTSW	1	116821480	missense
Z1088:Gm19965	UTSW	1	116804600	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CCAGTCTTCTTTGCAACAGC -3'
(R):5'- GTGGACTGTGTAAAAGATTTTCCAC -3'

Sequencing Primer
(F):5'- TTGCAACAGCAAACCATAGAG -3'
(R):5'- GGCAAACTTTAAGACTTGAGG -3'

Posted On

2017-02-10