Incidental Mutation 'R5856:Pou2f1'
ID 454893
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene Name POU domain, class 2, transcription factor 1
Synonyms Oct-1z, Oct-1A, Oct-1B, Oct-1C, oct-1, Oct1, 2810482H01Rik, Otf-1, Otf1
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165692723-165830247 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 165742699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 65 (A65T)
Ref Sequence ENSEMBL: ENSMUSP00000135565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000177358] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000184643] [ENSMUST00000159212]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000027850
AA Change: A88T
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: A88T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000069609
AA Change: A77T
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: A77T

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082225
SMART Domains Protein: ENSMUSP00000080856
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
POU 233 309 4.88e-27 SMART
low complexity region 310 326 N/A INTRINSIC
HOX 336 398 2.54e-19 SMART
low complexity region 416 442 N/A INTRINSIC
low complexity region 447 514 N/A INTRINSIC
low complexity region 523 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111426
AA Change: A77T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: A77T

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111427
AA Change: A77T
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: A77T

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111429
AA Change: A65T
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: A65T

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177358
AA Change: A65T

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135565
Gene: ENSMUSG00000026565
AA Change: A65T

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160260
AA Change: A88T
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: A88T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160908
AA Change: A88T
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: A88T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184643
AA Change: A65T
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565
AA Change: A65T

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176942
SMART Domains Protein: ENSMUSP00000135052
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 65 94 N/A INTRINSIC
low complexity region 112 154 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
low complexity region 205 226 N/A INTRINSIC
low complexity region 233 251 N/A INTRINSIC
POU 275 349 1.55e-52 SMART
low complexity region 350 366 N/A INTRINSIC
HOX 376 438 2.54e-19 SMART
low complexity region 456 482 N/A INTRINSIC
low complexity region 487 554 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177472
Predicted Effect probably benign
Transcript: ENSMUST00000159212
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165,729,867 (GRCm39) missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165,724,159 (GRCm39) splice site probably benign
IGL01627:Pou2f1 APN 1 165,708,002 (GRCm39) unclassified probably benign
IGL01707:Pou2f1 APN 1 165,742,685 (GRCm39) missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165,703,396 (GRCm39) missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165,710,685 (GRCm39) nonsense probably null
IGL03117:Pou2f1 APN 1 165,762,382 (GRCm39) missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165,724,049 (GRCm39) missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165,703,587 (GRCm39) missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165,719,399 (GRCm39) missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165,707,925 (GRCm39) unclassified probably benign
R3722:Pou2f1 UTSW 1 165,722,538 (GRCm39) missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165,722,538 (GRCm39) missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165,722,538 (GRCm39) missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165,722,538 (GRCm39) missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165,738,889 (GRCm39) missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165,722,575 (GRCm39) missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165,722,575 (GRCm39) missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165,740,830 (GRCm39) missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165,719,517 (GRCm39) intron probably benign
R4838:Pou2f1 UTSW 1 165,744,492 (GRCm39) missense probably null 1.00
R5579:Pou2f1 UTSW 1 165,742,731 (GRCm39) missense probably damaging 1.00
R5951:Pou2f1 UTSW 1 165,710,625 (GRCm39) unclassified probably benign
R6128:Pou2f1 UTSW 1 165,703,056 (GRCm39) unclassified probably benign
R6145:Pou2f1 UTSW 1 165,703,002 (GRCm39) unclassified probably benign
R6216:Pou2f1 UTSW 1 165,707,889 (GRCm39) unclassified probably benign
R6971:Pou2f1 UTSW 1 165,759,258 (GRCm39) missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165,742,684 (GRCm39) missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165,738,955 (GRCm39) missense unknown
R7404:Pou2f1 UTSW 1 165,738,955 (GRCm39) missense unknown
R7741:Pou2f1 UTSW 1 165,703,444 (GRCm39) missense probably damaging 0.98
R8011:Pou2f1 UTSW 1 165,722,472 (GRCm39) critical splice donor site probably null
R8478:Pou2f1 UTSW 1 165,759,287 (GRCm39) start codon destroyed probably null
R8804:Pou2f1 UTSW 1 165,708,039 (GRCm39) missense unknown
R8892:Pou2f1 UTSW 1 165,708,027 (GRCm39) missense unknown
R9126:Pou2f1 UTSW 1 165,722,603 (GRCm39) missense unknown
R9151:Pou2f1 UTSW 1 165,703,640 (GRCm39) intron probably benign
R9469:Pou2f1 UTSW 1 165,740,830 (GRCm39) missense probably benign 0.29
R9665:Pou2f1 UTSW 1 165,703,600 (GRCm39) missense probably damaging 0.99
RF012:Pou2f1 UTSW 1 165,740,800 (GRCm39) missense unknown
X0022:Pou2f1 UTSW 1 165,724,025 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCACCTTTGGCTCACACA -3'
(R):5'- AATGGCATGCTGACTGATGG -3'

Sequencing Primer
(F):5'- TTTGGCTCACACACACAGCAG -3'
(R):5'- CATGCTGACTGATGGTGCGC -3'
Posted On 2017-02-10