Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Arhgap11a'

454895

Institutional Source

Beutler Lab

Gene Symbol

Arhgap11a

Ensembl Gene

ENSMUSG00000041219

Gene Name

Rho GTPase activating protein 11A

Synonyms

GAP (1-12), 6530401L14Rik

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113831492-113848661 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113833771 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 722 (N722K)

Ref Sequence

ENSEMBL: ENSMUSP00000106574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024005] [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]

AlphaFold

Q80Y19

Predicted Effect

probably benign
Transcript: ENSMUST00000024005

SMART Domains

Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236

Domain	Start	End	E-Value	Type
Pfam:Secretogranin_V	23	160	4e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102545
AA Change: N722K

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: N722K

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	3e-20	BLAST
low complexity region	490	501	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110947

SMART Domains

Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	7e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000110948

SMART Domains

Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	6e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110949
AA Change: N722K

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: N722K

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	3e-20	BLAST
low complexity region	490	501	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Arhgap11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Arhgap11a	APN	2	113834256	missense	probably benign	0.00
IGL00337:Arhgap11a	APN	2	113841942	missense	probably damaging	0.96
IGL00532:Arhgap11a	APN	2	113834066	missense	probably benign
IGL00869:Arhgap11a	APN	2	113834826	missense	probably damaging	0.99
IGL01123:Arhgap11a	APN	2	113834773	splice site	probably benign
IGL01353:Arhgap11a	APN	2	113833524	missense	probably damaging	1.00
IGL01725:Arhgap11a	APN	2	113837552	missense	probably damaging	0.98
IGL01911:Arhgap11a	APN	2	113840732	missense	probably damaging	1.00
IGL02077:Arhgap11a	APN	2	113837471	missense	possibly damaging	0.94
IGL02532:Arhgap11a	APN	2	113833676	nonsense	probably null
IGL02553:Arhgap11a	APN	2	113837561	splice site	probably benign
IGL02738:Arhgap11a	APN	2	113832975	makesense	probably null
IGL02945:Arhgap11a	APN	2	113837473	missense	possibly damaging	0.83
R0480:Arhgap11a	UTSW	2	113839818	missense	probably benign	0.03
R0515:Arhgap11a	UTSW	2	113837471	missense	possibly damaging	0.48
R0625:Arhgap11a	UTSW	2	113841711	missense	probably benign	0.01
R0898:Arhgap11a	UTSW	2	113836876	missense	probably benign	0.01
R1248:Arhgap11a	UTSW	2	113834102	missense	possibly damaging	0.63
R1395:Arhgap11a	UTSW	2	113833122	missense	probably benign	0.00
R1669:Arhgap11a	UTSW	2	113841912	missense	possibly damaging	0.92
R2915:Arhgap11a	UTSW	2	113833508	missense	probably damaging	1.00
R3941:Arhgap11a	UTSW	2	113836897	missense	probably damaging	1.00
R4194:Arhgap11a	UTSW	2	113841994	missense	probably benign	0.02
R4508:Arhgap11a	UTSW	2	113842042	missense	probably damaging	1.00
R4617:Arhgap11a	UTSW	2	113834078	missense	probably benign	0.01
R4839:Arhgap11a	UTSW	2	113842029	missense	probably damaging	1.00
R4842:Arhgap11a	UTSW	2	113839762	missense	probably damaging	0.98
R5507:Arhgap11a	UTSW	2	113841678	missense	probably benign
R5538:Arhgap11a	UTSW	2	113837530	missense	probably benign
R5660:Arhgap11a	UTSW	2	113841910	missense	possibly damaging	0.80
R5712:Arhgap11a	UTSW	2	113845301	missense	probably benign	0.09
R5849:Arhgap11a	UTSW	2	113834847	missense	probably null	0.01
R6101:Arhgap11a	UTSW	2	113834874	nonsense	probably null
R6119:Arhgap11a	UTSW	2	113834350	missense	probably benign
R6338:Arhgap11a	UTSW	2	113833725	missense	probably benign	0.37
R6563:Arhgap11a	UTSW	2	113833902	missense	probably benign	0.00
R6919:Arhgap11a	UTSW	2	113839709	missense	possibly damaging	0.94
R7798:Arhgap11a	UTSW	2	113843335	missense	probably damaging	0.98
R7819:Arhgap11a	UTSW	2	113834918	critical splice acceptor site	probably null
R8208:Arhgap11a	UTSW	2	113842939	missense	probably benign	0.10
R8806:Arhgap11a	UTSW	2	113834762	missense	possibly damaging	0.96
R9026:Arhgap11a	UTSW	2	113834066	missense	probably benign	0.01
R9150:Arhgap11a	UTSW	2	113843269	missense	possibly damaging	0.81
R9428:Arhgap11a	UTSW	2	113836934	missense	probably benign
R9578:Arhgap11a	UTSW	2	113839780	missense	possibly damaging	0.95
X0065:Arhgap11a	UTSW	2	113834231	missense	probably benign	0.41
Z1088:Arhgap11a	UTSW	2	113842894	missense	probably damaging	1.00
Z1176:Arhgap11a	UTSW	2	113833758	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- GATCAGAAACCTTCCCGTGC -3'
(R):5'- CCTTCAGAACGGAATTTCTCACCG -3'

Sequencing Primer
(F):5'- CCGTGCTCTGTCACTTGTAGAG -3'
(R):5'- CCGGATCAAAGCCCAGAGTTTG -3'

Posted On

2017-02-10