Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Rxfp1'

454897

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79663313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 271 (N271Y)

Ref Sequence

ENSEMBL: ENSMUSP00000077611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

AlphaFold

Q6R6I7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078527
AA Change: N271Y

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: N271Y

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183040

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
R8723:Rxfp1	UTSW	3	79650495	missense	probably benign
R8786:Rxfp1	UTSW	3	79663370	critical splice acceptor site	probably null
R8887:Rxfp1	UTSW	3	79651982	intron	probably benign
R8939:Rxfp1	UTSW	3	79644924	missense	probably damaging	0.99
R9245:Rxfp1	UTSW	3	79644954	missense	probably benign	0.12
R9574:Rxfp1	UTSW	3	79656274	missense	probably benign	0.01
R9579:Rxfp1	UTSW	3	79650639	missense	probably damaging	1.00
R9799:Rxfp1	UTSW	3	79670875	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATAGACACCTACCGGGAGAAACC -3'
(R):5'- AACTATTGCTACAGATGACAGGCA -3'

Sequencing Primer
(F):5'- GATCACTATGTAGATCAGGCTAGCC -3'
(R):5'- TGCTACAGATGACAGGCAATAATAC -3'

Posted On

2017-02-10