Incidental Mutation 'R5856:Tet2'
ID 454899
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Name tet methylcytosine dioxygenase 2
Synonyms E130014J05Rik, Ayu17-449
MMRRC Submission 043230-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Essential gene? Essential (E-score: 1.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 133463679-133545139 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133486640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 678 (S678P)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]
AlphaFold Q4JK59
Predicted Effect probably benign
Transcript: ENSMUST00000098603
AA Change: S678P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: S678P

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196398
AA Change: S678P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: S678P

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197118
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrf5 A G 17: 43,446,120 T497A probably benign Het
Ano5 T C 7: 51,585,326 I669T probably benign Het
Arhgap11a A T 2: 113,833,771 N722K possibly damaging Het
Atm A T 9: 53,495,955 I1161K possibly damaging Het
Atp13a4 T C 16: 29,433,987 T714A possibly damaging Het
BC051665 T A 13: 60,784,500 M92L probably benign Het
Car3 G A 3: 14,871,641 V255M probably damaging Het
Cnot11 C A 1: 39,537,453 F179L probably benign Het
Dctn1 A G 6: 83,197,865 Y1013C probably damaging Het
Gm19965 A G 1: 116,821,849 D420G probably benign Het
Gm5444 A G 13: 4,771,684 noncoding transcript Het
Hydin A T 8: 110,541,842 D2946V probably damaging Het
Hyou1 C T 9: 44,381,344 R119C probably damaging Het
Ighm A T 12: 113,421,602 L246Q unknown Het
Itpr3 A G 17: 27,106,405 E1324G probably damaging Het
Loxl4 G T 19: 42,595,366 Q749K possibly damaging Het
Muc2 C A 7: 141,745,644 probably benign Het
Myh11 T C 16: 14,205,976 T1505A probably benign Het
Nsmce2 A G 15: 59,378,943 E21G probably damaging Het
Olfr1220 T A 2: 89,097,910 I6F probably benign Het
Olfr273 T A 4: 52,856,516 probably benign Het
Plaa A G 4: 94,583,487 I375T probably benign Het
Pou2f1 C T 1: 165,915,130 A65T probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rxfp1 T A 3: 79,663,313 N271Y possibly damaging Het
Sema5b T G 16: 35,646,386 Y219* probably null Het
Slc35f3 G T 8: 126,321,080 R53L probably benign Het
Slc44a5 T C 3: 154,258,392 V465A possibly damaging Het
Slc9a5 A G 8: 105,357,165 I446V possibly damaging Het
Slf1 A T 13: 77,106,087 D204E possibly damaging Het
Sox5 T A 6: 144,209,362 T3S probably damaging Het
Srr G A 11: 74,913,012 R40C possibly damaging Het
Tas2r115 T A 6: 132,737,538 H150L possibly damaging Het
Tmem11 T C 11: 60,864,858 K183E probably damaging Het
Upf1 T C 8: 70,334,762 probably null Het
Xpo6 A T 7: 126,149,502 probably benign Het
Zfp638 C T 6: 83,977,065 S1384L probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R7978:Tet2 UTSW 3 133487665 missense possibly damaging 0.96
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
R8164:Tet2 UTSW 3 133467134 missense possibly damaging 0.85
R8236:Tet2 UTSW 3 133487786 missense probably benign 0.00
R8755:Tet2 UTSW 3 133488278 missense probably damaging 0.99
R8962:Tet2 UTSW 3 133488043 missense probably benign 0.22
R9009:Tet2 UTSW 3 133487599 missense possibly damaging 0.86
R9014:Tet2 UTSW 3 133467188 missense probably damaging 0.99
R9128:Tet2 UTSW 3 133469613 missense possibly damaging 0.85
R9166:Tet2 UTSW 3 133468172 missense probably damaging 1.00
R9190:Tet2 UTSW 3 133481386 missense possibly damaging 0.73
R9344:Tet2 UTSW 3 133469354 missense possibly damaging 0.86
R9360:Tet2 UTSW 3 133487142 missense possibly damaging 0.72
R9471:Tet2 UTSW 3 133485919 missense probably damaging 1.00
R9488:Tet2 UTSW 3 133487342 missense probably benign 0.18
R9534:Tet2 UTSW 3 133467928 nonsense probably null
R9557:Tet2 UTSW 3 133485805 missense probably benign
R9621:Tet2 UTSW 3 133488006 nonsense probably null
R9644:Tet2 UTSW 3 133487303 nonsense probably null
R9719:Tet2 UTSW 3 133486042 missense possibly damaging 0.86
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCGACACAAAAGCTTTCTTC -3'
(R):5'- GGGACCAACATCTTCAGTTCC -3'

Sequencing Primer
(F):5'- TCCACTTTAATCTGGCCAAAGC -3'
(R):5'- TCCAGAAAGCTTTATACCAGGAGTGC -3'
Posted On 2017-02-10