Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Tet2'

454899

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

043230-MU

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133486640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 678 (S678P)

Ref Sequence

ENSEMBL: ENSMUSP00000143029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

AlphaFold

Q4JK59

Predicted Effect

probably benign
Transcript: ENSMUST00000098603
AA Change: S678P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: S678P

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196398
AA Change: S678P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: S678P

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
R7978:Tet2	UTSW	3	133487665	missense	possibly damaging	0.96
R8055:Tet2	UTSW	3	133467992	missense	possibly damaging	0.93
R8164:Tet2	UTSW	3	133467134	missense	possibly damaging	0.85
R8236:Tet2	UTSW	3	133487786	missense	probably benign	0.00
R8755:Tet2	UTSW	3	133488278	missense	probably damaging	0.99
R8962:Tet2	UTSW	3	133488043	missense	probably benign	0.22
R9009:Tet2	UTSW	3	133487599	missense	possibly damaging	0.86
R9014:Tet2	UTSW	3	133467188	missense	probably damaging	0.99
R9128:Tet2	UTSW	3	133469613	missense	possibly damaging	0.85
R9166:Tet2	UTSW	3	133468172	missense	probably damaging	1.00
R9190:Tet2	UTSW	3	133481386	missense	possibly damaging	0.73
R9344:Tet2	UTSW	3	133469354	missense	possibly damaging	0.86
R9360:Tet2	UTSW	3	133487142	missense	possibly damaging	0.72
R9471:Tet2	UTSW	3	133485919	missense	probably damaging	1.00
R9488:Tet2	UTSW	3	133487342	missense	probably benign	0.18
R9534:Tet2	UTSW	3	133467928	nonsense	probably null
R9557:Tet2	UTSW	3	133485805	missense	probably benign
R9621:Tet2	UTSW	3	133488006	nonsense	probably null
R9644:Tet2	UTSW	3	133487303	nonsense	probably null
R9719:Tet2	UTSW	3	133486042	missense	possibly damaging	0.86
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCCGACACAAAAGCTTTCTTC -3'
(R):5'- GGGACCAACATCTTCAGTTCC -3'

Sequencing Primer
(F):5'- TCCACTTTAATCTGGCCAAAGC -3'
(R):5'- TCCAGAAAGCTTTATACCAGGAGTGC -3'

Posted On

2017-02-10