Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Slc44a5'

454900

Institutional Source

Beutler Lab

Gene Symbol

Slc44a5

Ensembl Gene

ENSMUSG00000028360

Gene Name

solute carrier family 44, member 5

Synonyms

LOC242259

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153973436-154271722 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 154258392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 465 (V465A)

Ref Sequence

ENSEMBL: ENSMUSP00000087394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089948]

AlphaFold

Q5RJI2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089948
AA Change: V465A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: V465A

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	234	256	N/A	INTRINSIC
transmembrane domain	263	285	N/A	INTRINSIC
Pfam:Choline_transpo	323	683	6.3e-114	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144677

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Slc44a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Slc44a5	APN	3	154262939	missense	probably damaging	1.00
IGL02187:Slc44a5	APN	3	154262917	missense	probably benign	0.00
IGL02219:Slc44a5	APN	3	154239159	missense	possibly damaging	0.76
IGL02220:Slc44a5	APN	3	154250971	missense	possibly damaging	0.94
IGL02314:Slc44a5	APN	3	154256519	missense	probably damaging	1.00
IGL02471:Slc44a5	APN	3	154256576	missense	probably damaging	1.00
IGL02869:Slc44a5	APN	3	154251014	missense	probably damaging	0.97
IGL03117:Slc44a5	APN	3	154251077	missense	probably benign	0.15
IGL03144:Slc44a5	APN	3	154243540	missense	possibly damaging	0.78
PIT4486001:Slc44a5	UTSW	3	154259022	missense	possibly damaging	0.50
R0026:Slc44a5	UTSW	3	154240270	splice site	probably benign
R0190:Slc44a5	UTSW	3	154239118	missense	probably null	0.00
R0306:Slc44a5	UTSW	3	154270001	missense	probably damaging	1.00
R0591:Slc44a5	UTSW	3	154234145	splice site	probably benign
R0744:Slc44a5	UTSW	3	154265474	missense	probably damaging	1.00
R0833:Slc44a5	UTSW	3	154265474	missense	probably damaging	1.00
R0919:Slc44a5	UTSW	3	154243586	missense	probably damaging	1.00
R1170:Slc44a5	UTSW	3	154257720	splice site	probably null
R1370:Slc44a5	UTSW	3	154243159	missense	probably benign	0.26
R1613:Slc44a5	UTSW	3	154257714	splice site	probably null
R1713:Slc44a5	UTSW	3	154239106	missense	probably damaging	0.97
R1999:Slc44a5	UTSW	3	154258493	missense	possibly damaging	0.61
R2143:Slc44a5	UTSW	3	154258449	missense	probably benign	0.01
R2293:Slc44a5	UTSW	3	154240297	missense	probably benign	0.01
R2367:Slc44a5	UTSW	3	154247809	missense	possibly damaging	0.94
R3842:Slc44a5	UTSW	3	154261394	splice site	probably benign
R3953:Slc44a5	UTSW	3	154171572	missense	probably benign	0.03
R4163:Slc44a5	UTSW	3	154261373	missense	possibly damaging	0.94
R4509:Slc44a5	UTSW	3	154234073	missense	probably damaging	1.00
R4657:Slc44a5	UTSW	3	154256584	missense	possibly damaging	0.81
R4936:Slc44a5	UTSW	3	154253716	missense	probably damaging	1.00
R4937:Slc44a5	UTSW	3	154243615	critical splice donor site	probably null
R5083:Slc44a5	UTSW	3	154247787	missense	probably benign	0.31
R5257:Slc44a5	UTSW	3	154243123	missense	probably damaging	1.00
R5580:Slc44a5	UTSW	3	154261285	missense	probably benign	0.03
R5586:Slc44a5	UTSW	3	154270165	utr 3 prime	probably benign
R5894:Slc44a5	UTSW	3	154256573	missense	probably damaging	1.00
R6228:Slc44a5	UTSW	3	154239163	missense	probably benign	0.00
R6248:Slc44a5	UTSW	3	154264041	missense	possibly damaging	0.93
R6413:Slc44a5	UTSW	3	154257750	missense	probably benign	0.21
R6454:Slc44a5	UTSW	3	154243159	missense	probably benign	0.26
R6594:Slc44a5	UTSW	3	154259023	missense	possibly damaging	0.85
R6761:Slc44a5	UTSW	3	154240077	splice site	probably null
R6931:Slc44a5	UTSW	3	154258506	missense	probably benign	0.03
R7027:Slc44a5	UTSW	3	154253719	missense	probably benign	0.00
R7566:Slc44a5	UTSW	3	154269989	missense	probably damaging	1.00
R7688:Slc44a5	UTSW	3	153973800	critical splice donor site	probably null
R8011:Slc44a5	UTSW	3	154247810	missense	possibly damaging	0.71
R8085:Slc44a5	UTSW	3	154222777	missense	probably damaging	1.00
R8460:Slc44a5	UTSW	3	154270030	missense	probably benign	0.00
R8765:Slc44a5	UTSW	3	154262924	missense	probably damaging	0.99
R9154:Slc44a5	UTSW	3	154247736	missense	probably benign	0.08
R9291:Slc44a5	UTSW	3	154256581	missense	possibly damaging	0.82
R9328:Slc44a5	UTSW	3	154259041	missense	probably benign	0.37
R9647:Slc44a5	UTSW	3	154247733	missense	possibly damaging	0.89
R9666:Slc44a5	UTSW	3	154240289	missense	probably benign	0.03
R9695:Slc44a5	UTSW	3	154250951	missense	probably damaging	0.99
R9758:Slc44a5	UTSW	3	154253685	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGAAACAAGCTCTTCCCAG -3'
(R):5'- TACCAGAGCACAAACTGTAAGG -3'

Sequencing Primer
(F):5'- TATGCAATTGGGGGCCAC -3'
(R):5'- CACAAACTGTAAGGGAGCAAAG -3'

Posted On

2017-02-10