Incidental Mutation 'R5856:Slc44a5'
ID 454900
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Name solute carrier family 44, member 5
Synonyms LOC242259
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 153679073-153977359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 153964029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 465 (V465A)
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
AlphaFold Q5RJI2
Predicted Effect possibly damaging
Transcript: ENSMUST00000089948
AA Change: V465A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: V465A

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 153,968,576 (GRCm39) missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 153,968,554 (GRCm39) missense probably benign 0.00
IGL02219:Slc44a5 APN 3 153,944,796 (GRCm39) missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 153,956,608 (GRCm39) missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 153,962,156 (GRCm39) missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 153,962,213 (GRCm39) missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 153,956,651 (GRCm39) missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 153,956,714 (GRCm39) missense probably benign 0.15
IGL03144:Slc44a5 APN 3 153,949,177 (GRCm39) missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 153,964,659 (GRCm39) missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 153,945,907 (GRCm39) splice site probably benign
R0190:Slc44a5 UTSW 3 153,944,755 (GRCm39) missense probably null 0.00
R0306:Slc44a5 UTSW 3 153,975,638 (GRCm39) missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 153,939,782 (GRCm39) splice site probably benign
R0744:Slc44a5 UTSW 3 153,971,111 (GRCm39) missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 153,971,111 (GRCm39) missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 153,949,223 (GRCm39) missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 153,963,357 (GRCm39) splice site probably null
R1370:Slc44a5 UTSW 3 153,948,796 (GRCm39) missense probably benign 0.26
R1613:Slc44a5 UTSW 3 153,963,351 (GRCm39) splice site probably null
R1713:Slc44a5 UTSW 3 153,944,743 (GRCm39) missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 153,964,130 (GRCm39) missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 153,964,086 (GRCm39) missense probably benign 0.01
R2293:Slc44a5 UTSW 3 153,945,934 (GRCm39) missense probably benign 0.01
R2367:Slc44a5 UTSW 3 153,953,446 (GRCm39) missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 153,967,031 (GRCm39) splice site probably benign
R3953:Slc44a5 UTSW 3 153,877,209 (GRCm39) missense probably benign 0.03
R4163:Slc44a5 UTSW 3 153,967,010 (GRCm39) missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 153,939,710 (GRCm39) missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 153,962,221 (GRCm39) missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 153,959,353 (GRCm39) missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 153,949,252 (GRCm39) critical splice donor site probably null
R5083:Slc44a5 UTSW 3 153,953,424 (GRCm39) missense probably benign 0.31
R5257:Slc44a5 UTSW 3 153,948,760 (GRCm39) missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 153,966,922 (GRCm39) missense probably benign 0.03
R5586:Slc44a5 UTSW 3 153,975,802 (GRCm39) utr 3 prime probably benign
R5894:Slc44a5 UTSW 3 153,962,210 (GRCm39) missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 153,944,800 (GRCm39) missense probably benign 0.00
R6248:Slc44a5 UTSW 3 153,969,678 (GRCm39) missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 153,963,387 (GRCm39) missense probably benign 0.21
R6454:Slc44a5 UTSW 3 153,948,796 (GRCm39) missense probably benign 0.26
R6594:Slc44a5 UTSW 3 153,964,660 (GRCm39) missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 153,945,714 (GRCm39) splice site probably null
R6931:Slc44a5 UTSW 3 153,964,143 (GRCm39) missense probably benign 0.03
R7027:Slc44a5 UTSW 3 153,959,356 (GRCm39) missense probably benign 0.00
R7566:Slc44a5 UTSW 3 153,975,626 (GRCm39) missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153,679,437 (GRCm39) critical splice donor site probably null
R8011:Slc44a5 UTSW 3 153,953,447 (GRCm39) missense possibly damaging 0.71
R8085:Slc44a5 UTSW 3 153,928,414 (GRCm39) missense probably damaging 1.00
R8460:Slc44a5 UTSW 3 153,975,667 (GRCm39) missense probably benign 0.00
R8765:Slc44a5 UTSW 3 153,968,561 (GRCm39) missense probably damaging 0.99
R9154:Slc44a5 UTSW 3 153,953,373 (GRCm39) missense probably benign 0.08
R9291:Slc44a5 UTSW 3 153,962,218 (GRCm39) missense possibly damaging 0.82
R9328:Slc44a5 UTSW 3 153,964,678 (GRCm39) missense probably benign 0.37
R9647:Slc44a5 UTSW 3 153,953,370 (GRCm39) missense possibly damaging 0.89
R9666:Slc44a5 UTSW 3 153,945,926 (GRCm39) missense probably benign 0.03
R9695:Slc44a5 UTSW 3 153,956,588 (GRCm39) missense probably damaging 0.99
R9758:Slc44a5 UTSW 3 153,959,322 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAACAAGCTCTTCCCAG -3'
(R):5'- TACCAGAGCACAAACTGTAAGG -3'

Sequencing Primer
(F):5'- TATGCAATTGGGGGCCAC -3'
(R):5'- CACAAACTGTAAGGGAGCAAAG -3'
Posted On 2017-02-10