Incidental Mutation 'R5856:4930553M12Rik'
ID 454902
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene Name RIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 88785470-88786617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88786596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 7 (I7M)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057837]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: I7M
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88,786,310 (GRCm39) nonsense probably null
R0194:4930553M12Rik UTSW 4 88,786,480 (GRCm39) missense unknown
R2143:4930553M12Rik UTSW 4 88,786,412 (GRCm39) missense unknown
R2143:4930553M12Rik UTSW 4 88,786,411 (GRCm39) missense unknown
R2144:4930553M12Rik UTSW 4 88,786,412 (GRCm39) missense unknown
R2144:4930553M12Rik UTSW 4 88,786,411 (GRCm39) missense unknown
R5135:4930553M12Rik UTSW 4 88,786,508 (GRCm39) missense unknown
R5822:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R5848:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R5849:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R5850:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R5854:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R6128:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R6130:4930553M12Rik UTSW 4 88,786,596 (GRCm39) missense unknown
R7054:4930553M12Rik UTSW 4 88,786,486 (GRCm39) missense unknown
R7292:4930553M12Rik UTSW 4 88,786,568 (GRCm39) missense unknown
R7754:4930553M12Rik UTSW 4 88,786,496 (GRCm39) missense unknown
R7844:4930553M12Rik UTSW 4 88,786,423 (GRCm39) missense unknown
R7980:4930553M12Rik UTSW 4 88,786,315 (GRCm39) missense unknown
R9417:4930553M12Rik UTSW 4 88,786,202 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTCTCGCCCAAAGAATC -3'
(R):5'- AGACAAAGAATATTCTGGCACTGG -3'

Sequencing Primer
(F):5'- AAAGAATCCGCTTATTCCCCTG -3'
(R):5'- CCTTTTGGAGCCAGCCAAC -3'
Posted On 2017-02-10