Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Dctn1'

454904

Institutional Source

Beutler Lab

Gene Symbol

Dctn1

Ensembl Gene

ENSMUSG00000031865

Gene Name

dynactin 1

Synonyms

p150, Glued, p150

MMRRC Submission

043230-MU

Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83165920-83200117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83197865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1013 (Y1013C)

Ref Sequence

ENSEMBL: ENSMUSP00000109540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]

AlphaFold

O08788

Predicted Effect

probably damaging
Transcript: ENSMUST00000077407
AA Change: Y1110C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: Y1110C

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC
SCOP:d1fxkc_	185	337	3e-3	SMART
low complexity region	363	379	N/A	INTRINSIC
Pfam:Dynactin	489	768	8.2e-91	PFAM
low complexity region	800	820	N/A	INTRINSIC
coiled coil region	914	1009	N/A	INTRINSIC
low complexity region	1025	1043	N/A	INTRINSIC
coiled coil region	1143	1172	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113907
AA Change: Y1013C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: Y1013C

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
low complexity region	27	50	N/A	INTRINSIC
low complexity region	51	80	N/A	INTRINSIC
low complexity region	93	106	N/A	INTRINSIC
low complexity region	140	158	N/A	INTRINSIC
SCOP:d1lxa__	271	345	8e-3	SMART
Pfam:Dynactin	392	671	7.1e-91	PFAM
low complexity region	703	723	N/A	INTRINSIC
coiled coil region	817	912	N/A	INTRINSIC
low complexity region	928	946	N/A	INTRINSIC
coiled coil region	1046	1075	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113913
AA Change: Y1135C

SMART Domains

Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: Y1135C

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	167	N/A	INTRINSIC
low complexity region	168	197	N/A	INTRINSIC
SCOP:d1fxkc_	205	357	3e-3	SMART
low complexity region	383	399	N/A	INTRINSIC
Pfam:Dynactin	509	788	2.5e-90	PFAM
low complexity region	820	840	N/A	INTRINSIC
coiled coil region	934	1029	N/A	INTRINSIC
low complexity region	1051	1069	N/A	INTRINSIC
coiled coil region	1168	1197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113918
AA Change: Y1114C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: Y1114C

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
low complexity region	227	240	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	526	805	3.3e-90	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
coiled coil region	1147	1176	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113919
AA Change: Y1152C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: Y1152C

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
SCOP:d1fxkc_	222	374	3e-3	SMART
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	522	805	1.4e-103	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
low complexity region	1068	1086	N/A	INTRINSIC
coiled coil region	1185	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127824

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153793

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154420

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Dctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Dctn1	APN	6	83179897	missense	probably benign	0.00
IGL01450:Dctn1	APN	6	83194110	unclassified	probably benign
IGL01876:Dctn1	APN	6	83197921	missense	probably damaging	1.00
IGL01958:Dctn1	APN	6	83191344	missense	possibly damaging	0.95
IGL02554:Dctn1	APN	6	83182722	missense	probably damaging	1.00
IGL02668:Dctn1	APN	6	83191048	missense	possibly damaging	0.89
IGL02814:Dctn1	APN	6	83189914	missense	probably damaging	1.00
IGL02818:Dctn1	APN	6	83192514	missense	possibly damaging	0.86
IGL03007:Dctn1	APN	6	83182708	missense	probably damaging	1.00
IGL03065:Dctn1	APN	6	83192493	missense	probably damaging	0.99
IGL03083:Dctn1	APN	6	83197484	splice site	probably benign
IGL03394:Dctn1	APN	6	83191284	missense	possibly damaging	0.61
E0374:Dctn1	UTSW	6	83194174	missense	possibly damaging	0.93
IGL03014:Dctn1	UTSW	6	83197369	intron	probably benign
PIT4812001:Dctn1	UTSW	6	83199762	missense	possibly damaging	0.86
R0044:Dctn1	UTSW	6	83191134	missense	probably damaging	1.00
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0057:Dctn1	UTSW	6	83179892	missense	probably benign	0.14
R0731:Dctn1	UTSW	6	83183089	missense	probably damaging	0.98
R0738:Dctn1	UTSW	6	83190107	critical splice donor site	probably null
R0755:Dctn1	UTSW	6	83189077	missense	probably damaging	0.96
R0839:Dctn1	UTSW	6	83190477	missense	possibly damaging	0.53
R1035:Dctn1	UTSW	6	83190220	missense	probably damaging	1.00
R1454:Dctn1	UTSW	6	83197508	missense	possibly damaging	0.93
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1627:Dctn1	UTSW	6	83195082	missense	probably damaging	0.99
R1631:Dctn1	UTSW	6	83197596	missense	possibly damaging	0.56
R1812:Dctn1	UTSW	6	83192518	missense	possibly damaging	0.85
R1928:Dctn1	UTSW	6	83199184	splice site	probably benign
R2008:Dctn1	UTSW	6	83189956	missense	probably damaging	0.99
R2242:Dctn1	UTSW	6	83199705	missense	probably damaging	0.99
R2259:Dctn1	UTSW	6	83197586	missense	possibly damaging	0.46
R2422:Dctn1	UTSW	6	83199800	missense	possibly damaging	0.92
R2483:Dctn1	UTSW	6	83194187	missense	probably damaging	1.00
R4455:Dctn1	UTSW	6	83195049	missense	probably damaging	1.00
R4724:Dctn1	UTSW	6	83189938	missense	possibly damaging	0.53
R4812:Dctn1	UTSW	6	83189937	missense	probably benign	0.24
R4819:Dctn1	UTSW	6	83190519	missense	probably damaging	0.97
R4831:Dctn1	UTSW	6	83199771	missense	possibly damaging	0.46
R4928:Dctn1	UTSW	6	83189207	missense	possibly damaging	0.73
R5087:Dctn1	UTSW	6	83191639	missense	probably damaging	1.00
R5354:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R5372:Dctn1	UTSW	6	83190210	missense	probably damaging	0.96
R5493:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5494:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5732:Dctn1	UTSW	6	83197949	critical splice donor site	probably null
R6025:Dctn1	UTSW	6	83193691	splice site	probably null
R6999:Dctn1	UTSW	6	83191281	missense	possibly damaging	0.89
R7052:Dctn1	UTSW	6	83195280	splice site	probably null
R7133:Dctn1	UTSW	6	83180044	splice site	probably null
R7485:Dctn1	UTSW	6	83189905	missense	possibly damaging	0.85
R7607:Dctn1	UTSW	6	83195069	nonsense	probably null
R7729:Dctn1	UTSW	6	83183060	missense	probably damaging	1.00
R7749:Dctn1	UTSW	6	83186141	intron	probably benign
R8282:Dctn1	UTSW	6	83199756	missense	possibly damaging	0.91
R8750:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R9126:Dctn1	UTSW	6	83192853	missense	probably damaging	0.99
R9208:Dctn1	UTSW	6	83199702	missense	probably benign	0.33
R9422:Dctn1	UTSW	6	83193709	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- TAAGGCACTCATGGGGATGTG -3'
(R):5'- CTGCATTCTGAAGCCAGTAGAC -3'

Sequencing Primer
(F):5'- GGTCATTGAAGGTCATTGAAGGTCAC -3'
(R):5'- TCTGAAGCCAGTAGACTCTGCTAG -3'

Posted On

2017-02-10