Incidental Mutation 'R5856:Dctn1'
ID 454904
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Name dynactin 1
Synonyms p150, Glued, p150
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 83142902-83177099 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83174847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1013 (Y1013C)
Ref Sequence ENSEMBL: ENSMUSP00000109540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]
AlphaFold O08788
Predicted Effect probably damaging
Transcript: ENSMUST00000077407
AA Change: Y1110C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: Y1110C

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113907
AA Change: Y1013C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: Y1013C

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113913
AA Change: Y1135C
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: Y1135C

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113918
AA Change: Y1114C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: Y1114C

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113919
AA Change: Y1152C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: Y1152C

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130917
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83,156,879 (GRCm39) missense probably benign 0.00
IGL01450:Dctn1 APN 6 83,171,092 (GRCm39) unclassified probably benign
IGL01876:Dctn1 APN 6 83,174,903 (GRCm39) missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83,168,326 (GRCm39) missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83,159,704 (GRCm39) missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83,168,030 (GRCm39) missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83,166,896 (GRCm39) missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83,169,496 (GRCm39) missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83,159,690 (GRCm39) missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83,169,475 (GRCm39) missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83,174,466 (GRCm39) splice site probably benign
IGL03394:Dctn1 APN 6 83,168,266 (GRCm39) missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83,171,156 (GRCm39) missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83,174,351 (GRCm39) intron probably benign
PIT4812001:Dctn1 UTSW 6 83,176,744 (GRCm39) missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83,168,116 (GRCm39) missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83,159,614 (GRCm39) nonsense probably null
R0047:Dctn1 UTSW 6 83,159,614 (GRCm39) nonsense probably null
R0057:Dctn1 UTSW 6 83,156,874 (GRCm39) missense probably benign 0.14
R0731:Dctn1 UTSW 6 83,160,071 (GRCm39) missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83,167,089 (GRCm39) critical splice donor site probably null
R0755:Dctn1 UTSW 6 83,166,059 (GRCm39) missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83,167,459 (GRCm39) missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83,167,202 (GRCm39) missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83,174,490 (GRCm39) missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83,169,871 (GRCm39) missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83,169,871 (GRCm39) missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83,172,064 (GRCm39) missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83,174,578 (GRCm39) missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83,169,500 (GRCm39) missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83,176,166 (GRCm39) splice site probably benign
R2008:Dctn1 UTSW 6 83,166,938 (GRCm39) missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83,176,687 (GRCm39) missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83,174,568 (GRCm39) missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83,176,782 (GRCm39) missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83,171,169 (GRCm39) missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83,172,031 (GRCm39) missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83,166,920 (GRCm39) missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83,166,919 (GRCm39) missense probably benign 0.24
R4819:Dctn1 UTSW 6 83,167,501 (GRCm39) missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83,176,753 (GRCm39) missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83,166,189 (GRCm39) missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83,168,621 (GRCm39) missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83,160,108 (GRCm39) missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83,167,192 (GRCm39) missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83,159,546 (GRCm39) missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83,159,546 (GRCm39) missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83,174,931 (GRCm39) critical splice donor site probably null
R6025:Dctn1 UTSW 6 83,170,673 (GRCm39) splice site probably null
R6999:Dctn1 UTSW 6 83,168,263 (GRCm39) missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83,172,262 (GRCm39) splice site probably null
R7133:Dctn1 UTSW 6 83,157,026 (GRCm39) splice site probably null
R7485:Dctn1 UTSW 6 83,166,887 (GRCm39) missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83,172,051 (GRCm39) nonsense probably null
R7729:Dctn1 UTSW 6 83,160,042 (GRCm39) missense probably damaging 1.00
R7749:Dctn1 UTSW 6 83,163,123 (GRCm39) intron probably benign
R8282:Dctn1 UTSW 6 83,176,738 (GRCm39) missense possibly damaging 0.91
R8750:Dctn1 UTSW 6 83,160,108 (GRCm39) missense possibly damaging 0.93
R9126:Dctn1 UTSW 6 83,169,835 (GRCm39) missense probably damaging 0.99
R9208:Dctn1 UTSW 6 83,176,684 (GRCm39) missense probably benign 0.33
R9422:Dctn1 UTSW 6 83,170,691 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAAGGCACTCATGGGGATGTG -3'
(R):5'- CTGCATTCTGAAGCCAGTAGAC -3'

Sequencing Primer
(F):5'- GGTCATTGAAGGTCATTGAAGGTCAC -3'
(R):5'- TCTGAAGCCAGTAGACTCTGCTAG -3'
Posted On 2017-02-10