Incidental Mutation 'R5856:Tas2r115'
ID 454906
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Name taste receptor, type 2, member 115
Synonyms T2R15, mt2r49, Tas2r15, mGR15
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 132714017-132714949 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 132714501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 150 (H150L)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
AlphaFold Q7M719
Predicted Effect possibly damaging
Transcript: ENSMUST00000095394
AA Change: H150L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: H150L

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132,714,741 (GRCm39) missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132,714,641 (GRCm39) missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132,714,576 (GRCm39) missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132,714,592 (GRCm39) missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132,714,430 (GRCm39) missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132,714,271 (GRCm39) missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132,714,682 (GRCm39) missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132,714,922 (GRCm39) missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132,714,442 (GRCm39) missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132,714,934 (GRCm39) missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132,714,470 (GRCm39) missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132,714,309 (GRCm39) missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132,714,321 (GRCm39) missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132,714,321 (GRCm39) missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132,714,495 (GRCm39) missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132,714,247 (GRCm39) missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132,714,124 (GRCm39) missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132,714,216 (GRCm39) missense probably damaging 1.00
R6927:Tas2r115 UTSW 6 132,714,895 (GRCm39) missense probably damaging 1.00
R7473:Tas2r115 UTSW 6 132,714,214 (GRCm39) missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132,714,643 (GRCm39) missense probably damaging 1.00
R8415:Tas2r115 UTSW 6 132,714,798 (GRCm39) missense probably damaging 1.00
R8495:Tas2r115 UTSW 6 132,714,887 (GRCm39) missense probably damaging 1.00
R9032:Tas2r115 UTSW 6 132,714,327 (GRCm39) missense probably benign 0.37
R9085:Tas2r115 UTSW 6 132,714,327 (GRCm39) missense probably benign 0.37
R9318:Tas2r115 UTSW 6 132,714,472 (GRCm39) missense probably benign 0.01
R9665:Tas2r115 UTSW 6 132,714,390 (GRCm39) missense probably benign 0.31
R9751:Tas2r115 UTSW 6 132,714,918 (GRCm39) missense possibly damaging 0.85
Z1088:Tas2r115 UTSW 6 132,714,044 (GRCm39) nonsense probably null
Z1176:Tas2r115 UTSW 6 132,714,819 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCTTTGGTGTAGTACTGC -3'
(R):5'- AGACTGCCTGGAATATAAGCAATC -3'

Sequencing Primer
(F):5'- GTGTAGTACTGCATCTTCCTTACATG -3'
(R):5'- CTGCCTGGAATATAAGCAATCATTTC -3'
Posted On 2017-02-10