Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Sox5'

454907

Institutional Source

Beutler Lab

Gene Symbol

Sox5

Ensembl Gene

ENSMUSG00000041540

Gene Name

SRY (sex determining region Y)-box 5

Synonyms

A730017D01Rik

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5856 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

143828425-144781977 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144209362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 3 (T3S)

Ref Sequence

ENSEMBL: ENSMUSP00000047567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111749] [ENSMUST00000170367]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000038815
AA Change: T3S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: T3S

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	272	N/A	INTRINSIC
low complexity region	336	348	N/A	INTRINSIC
low complexity region	431	445	N/A	INTRINSIC
coiled coil region	449	483	N/A	INTRINSIC
low complexity region	494	505	N/A	INTRINSIC
HMG	555	625	2.84e-26	SMART
low complexity region	686	708	N/A	INTRINSIC
low complexity region	729	750	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000077160
AA Change: T3S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: T3S

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	277	N/A	INTRINSIC
low complexity region	383	397	N/A	INTRINSIC
coiled coil region	401	435	N/A	INTRINSIC
low complexity region	446	457	N/A	INTRINSIC
HMG	507	577	2.84e-26	SMART
low complexity region	638	660	N/A	INTRINSIC
low complexity region	681	702	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000111749
AA Change: T3S

SMART Domains

Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: T3S

Domain	Start	End	E-Value	Type
low complexity region	132	143	N/A	INTRINSIC
coiled coil region	158	237	N/A	INTRINSIC
low complexity region	347	361	N/A	INTRINSIC
coiled coil region	365	399	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
HMG	471	541	2.84e-26	SMART
low complexity region	602	624	N/A	INTRINSIC
low complexity region	645	666	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142294

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149451

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150087

Predicted Effect

probably damaging
Transcript: ENSMUST00000170367
AA Change: T3S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: T3S

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	272	N/A	INTRINSIC
low complexity region	382	396	N/A	INTRINSIC
coiled coil region	400	434	N/A	INTRINSIC
low complexity region	445	456	N/A	INTRINSIC
HMG	506	576	2.84e-26	SMART
low complexity region	637	659	N/A	INTRINSIC
low complexity region	680	701	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Sox5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Sox5	APN	6	144116472	missense	probably damaging	0.96
IGL03217:Sox5	APN	6	143907497	missense	probably damaging	1.00
Stocking	UTSW	6	144116443	critical splice donor site	probably null
R0230:Sox5	UTSW	6	144209338	missense	probably benign	0.02
R0610:Sox5	UTSW	6	143833439	missense	possibly damaging	0.56
R1162:Sox5	UTSW	6	143960812	missense	probably damaging	1.00
R1857:Sox5	UTSW	6	143960815	missense	probably damaging	1.00
R1959:Sox5	UTSW	6	143874105	missense	possibly damaging	0.94
R4057:Sox5	UTSW	6	144116522	missense	probably damaging	1.00
R4164:Sox5	UTSW	6	144116480	missense	probably damaging	1.00
R4284:Sox5	UTSW	6	143835329	missense	probably damaging	1.00
R4430:Sox5	UTSW	6	144041274	missense	possibly damaging	0.57
R4470:Sox5	UTSW	6	143844765	missense	possibly damaging	0.54
R4471:Sox5	UTSW	6	143844765	missense	possibly damaging	0.54
R4672:Sox5	UTSW	6	143833349	missense	probably damaging	1.00
R4683:Sox5	UTSW	6	143833467	missense	probably damaging	0.99
R4693:Sox5	UTSW	6	143835316	missense	probably damaging	1.00
R4735:Sox5	UTSW	6	143960835	missense	probably damaging	1.00
R4745:Sox5	UTSW	6	143833488	missense	possibly damaging	0.53
R4762:Sox5	UTSW	6	143861383	critical splice donor site	probably null
R4996:Sox5	UTSW	6	144028344	nonsense	probably null
R5218:Sox5	UTSW	6	143960890	missense	possibly damaging	0.93
R5673:Sox5	UTSW	6	144116480	missense	probably damaging	1.00
R6249:Sox5	UTSW	6	143833283	missense	probably benign	0.33
R6394:Sox5	UTSW	6	144041313	missense	probably damaging	1.00
R6703:Sox5	UTSW	6	143833465	missense	probably damaging	1.00
R6812:Sox5	UTSW	6	144116443	critical splice donor site	probably null
R7312:Sox5	UTSW	6	144155033	missense	probably benign
R7543:Sox5	UTSW	6	143841179	missense	probably damaging	0.96
R8110:Sox5	UTSW	6	144116474	missense	possibly damaging	0.92
R8231:Sox5	UTSW	6	144028288	missense	probably damaging	0.98
R8250:Sox5	UTSW	6	144155051	missense	possibly damaging	0.85
R8705:Sox5	UTSW	6	144041286	missense	possibly damaging	0.50
R8937:Sox5	UTSW	6	143907443	missense	probably benign	0.00
R9182:Sox5	UTSW	6	143833392	missense	possibly damaging	0.51
R9193:Sox5	UTSW	6	143844844	missense	probably benign	0.27
R9740:Sox5	UTSW	6	144155221	missense	probably damaging	0.98
R9762:Sox5	UTSW	6	143874116	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAATCAGCTCCCAAGGCTG -3'
(R):5'- CCCTTTAAGAGAATGGTCAAGGAG -3'

Sequencing Primer
(F):5'- TCCCAAGGCTGCAGAGAC -3'
(R):5'- TGGTCAAGGAGTCCTAGGAG -3'

Posted On

2017-02-10