Incidental Mutation 'R5856:Sox5'
ID 454907
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene Name SRY (sex determining region Y)-box 5
Synonyms A730017D01Rik
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5856 (G1)
Quality Score 223
Status Not validated
Chromosome 6
Chromosomal Location 143774151-144727703 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144155088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 3 (T3S)
Ref Sequence ENSEMBL: ENSMUSP00000047567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111749] [ENSMUST00000170367]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038815
AA Change: T3S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: T3S

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077160
AA Change: T3S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: T3S

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111749
AA Change: T3S
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: T3S

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150087
Predicted Effect probably damaging
Transcript: ENSMUST00000170367
AA Change: T3S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: T3S

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149451
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144,062,198 (GRCm39) missense probably damaging 0.96
IGL03217:Sox5 APN 6 143,853,223 (GRCm39) missense probably damaging 1.00
Stocking UTSW 6 144,062,169 (GRCm39) critical splice donor site probably null
R0230:Sox5 UTSW 6 144,155,064 (GRCm39) missense probably benign 0.02
R0610:Sox5 UTSW 6 143,779,165 (GRCm39) missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143,906,538 (GRCm39) missense probably damaging 1.00
R1857:Sox5 UTSW 6 143,906,541 (GRCm39) missense probably damaging 1.00
R1959:Sox5 UTSW 6 143,819,831 (GRCm39) missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144,062,248 (GRCm39) missense probably damaging 1.00
R4164:Sox5 UTSW 6 144,062,206 (GRCm39) missense probably damaging 1.00
R4284:Sox5 UTSW 6 143,781,055 (GRCm39) missense probably damaging 1.00
R4430:Sox5 UTSW 6 143,987,000 (GRCm39) missense possibly damaging 0.57
R4470:Sox5 UTSW 6 143,790,491 (GRCm39) missense possibly damaging 0.54
R4471:Sox5 UTSW 6 143,790,491 (GRCm39) missense possibly damaging 0.54
R4672:Sox5 UTSW 6 143,779,075 (GRCm39) missense probably damaging 1.00
R4683:Sox5 UTSW 6 143,779,193 (GRCm39) missense probably damaging 0.99
R4693:Sox5 UTSW 6 143,781,042 (GRCm39) missense probably damaging 1.00
R4735:Sox5 UTSW 6 143,906,561 (GRCm39) missense probably damaging 1.00
R4745:Sox5 UTSW 6 143,779,214 (GRCm39) missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143,807,109 (GRCm39) critical splice donor site probably null
R4996:Sox5 UTSW 6 143,974,070 (GRCm39) nonsense probably null
R5218:Sox5 UTSW 6 143,906,616 (GRCm39) missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144,062,206 (GRCm39) missense probably damaging 1.00
R6249:Sox5 UTSW 6 143,779,009 (GRCm39) missense probably benign 0.33
R6394:Sox5 UTSW 6 143,987,039 (GRCm39) missense probably damaging 1.00
R6703:Sox5 UTSW 6 143,779,191 (GRCm39) missense probably damaging 1.00
R6812:Sox5 UTSW 6 144,062,169 (GRCm39) critical splice donor site probably null
R7312:Sox5 UTSW 6 144,100,759 (GRCm39) missense probably benign
R7543:Sox5 UTSW 6 143,786,905 (GRCm39) missense probably damaging 0.96
R8110:Sox5 UTSW 6 144,062,200 (GRCm39) missense possibly damaging 0.92
R8231:Sox5 UTSW 6 143,974,014 (GRCm39) missense probably damaging 0.98
R8250:Sox5 UTSW 6 144,100,777 (GRCm39) missense possibly damaging 0.85
R8705:Sox5 UTSW 6 143,987,012 (GRCm39) missense possibly damaging 0.50
R8937:Sox5 UTSW 6 143,853,169 (GRCm39) missense probably benign 0.00
R9182:Sox5 UTSW 6 143,779,118 (GRCm39) missense possibly damaging 0.51
R9193:Sox5 UTSW 6 143,790,570 (GRCm39) missense probably benign 0.27
R9740:Sox5 UTSW 6 144,100,947 (GRCm39) missense probably damaging 0.98
R9762:Sox5 UTSW 6 143,819,842 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCAGCTCCCAAGGCTG -3'
(R):5'- CCCTTTAAGAGAATGGTCAAGGAG -3'

Sequencing Primer
(F):5'- TCCCAAGGCTGCAGAGAC -3'
(R):5'- TGGTCAAGGAGTCCTAGGAG -3'
Posted On 2017-02-10