Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Ano5'

454908

Institutional Source

Beutler Lab

Gene Symbol

Ano5

Ensembl Gene

ENSMUSG00000055489

Gene Name

anoctamin 5

Synonyms

Gdd1, Tmem16e

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R5856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51511029-51598709 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51585326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 669 (I669T)

Ref Sequence

ENSEMBL: ENSMUSP00000046884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]

AlphaFold

Q75UR0

Predicted Effect

probably benign
Transcript: ENSMUST00000043944
AA Change: I669T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: I669T

Domain	Start	End	E-Value	Type
low complexity region	42	55	N/A	INTRINSIC
Pfam:Anoct_dimer	64	280	7.7e-70	PFAM
Pfam:Anoctamin	283	860	6.5e-138	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207044
AA Change: I636T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000207717
AA Change: I619T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Ano5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Ano5	APN	7	51566513	missense	probably damaging	0.96
IGL01328:Ano5	APN	7	51556271	critical splice donor site	probably null
IGL01800:Ano5	APN	7	51573075	critical splice donor site	probably null
IGL01888:Ano5	APN	7	51566300	missense	probably benign	0.06
IGL02221:Ano5	APN	7	51570323	missense	probably damaging	1.00
IGL02538:Ano5	APN	7	51583775	missense	probably damaging	1.00
IGL03027:Ano5	APN	7	51566277	missense	probably damaging	0.99
IGL03133:Ano5	APN	7	51576512	nonsense	probably null
IGL03167:Ano5	APN	7	51585511	missense	probably damaging	0.98
IGL03233:Ano5	APN	7	51570368	missense	probably damaging	1.00
PIT4466001:Ano5	UTSW	7	51544851	missense	probably damaging	1.00
R0233:Ano5	UTSW	7	51535470	missense	possibly damaging	0.94
R0233:Ano5	UTSW	7	51535470	missense	possibly damaging	0.94
R0675:Ano5	UTSW	7	51574810	missense	probably damaging	1.00
R0723:Ano5	UTSW	7	51587758	missense	probably benign	0.20
R0764:Ano5	UTSW	7	51537842	splice site	probably benign
R1159:Ano5	UTSW	7	51579474	splice site	probably benign
R1218:Ano5	UTSW	7	51570421	splice site	probably null
R1288:Ano5	UTSW	7	51546872	missense	probably damaging	1.00
R1329:Ano5	UTSW	7	51546785	missense	probably benign
R1484:Ano5	UTSW	7	51566320	missense	probably damaging	1.00
R1496:Ano5	UTSW	7	51583775	missense	probably damaging	1.00
R1512:Ano5	UTSW	7	51579568	missense	probably benign	0.00
R1691:Ano5	UTSW	7	51590579	missense	probably damaging	1.00
R1859:Ano5	UTSW	7	51546833	missense	probably damaging	1.00
R1991:Ano5	UTSW	7	51537813	missense	possibly damaging	0.59
R2066:Ano5	UTSW	7	51585386	missense	probably damaging	1.00
R2088:Ano5	UTSW	7	51587706	missense	possibly damaging	0.50
R2103:Ano5	UTSW	7	51537813	missense	possibly damaging	0.59
R2248:Ano5	UTSW	7	51593789	missense	probably benign	0.00
R3692:Ano5	UTSW	7	51590579	missense	probably damaging	1.00
R3723:Ano5	UTSW	7	51576528	missense	probably damaging	1.00
R3805:Ano5	UTSW	7	51576650	missense	probably benign	0.22
R3883:Ano5	UTSW	7	51566304	missense	probably damaging	1.00
R3978:Ano5	UTSW	7	51587806	missense	probably benign
R4035:Ano5	UTSW	7	51566485	splice site	probably benign
R4239:Ano5	UTSW	7	51587666	missense	probably damaging	0.99
R4466:Ano5	UTSW	7	51570275	missense	probably damaging	1.00
R4644:Ano5	UTSW	7	51587685	nonsense	probably null
R5021:Ano5	UTSW	7	51556185	missense	probably benign
R5028:Ano5	UTSW	7	51537710	splice site	probably null
R5609:Ano5	UTSW	7	51593637	missense	probably damaging	1.00
R5659:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5660:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5680:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5786:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5787:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5788:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5930:Ano5	UTSW	7	51585331	missense	probably damaging	0.99
R5984:Ano5	UTSW	7	51593664	missense	probably damaging	1.00
R6015:Ano5	UTSW	7	51574777	missense	probably benign	0.00
R6030:Ano5	UTSW	7	51574825	missense	probably damaging	1.00
R6030:Ano5	UTSW	7	51574825	missense	probably damaging	1.00
R6247:Ano5	UTSW	7	51566131	splice site	probably null
R7552:Ano5	UTSW	7	51546780	missense	probably benign	0.31
R7559:Ano5	UTSW	7	51574888	missense	probably damaging	1.00
R7712:Ano5	UTSW	7	51573057	missense	probably benign	0.00
R7712:Ano5	UTSW	7	51590655	missense	probably damaging	1.00
R7805:Ano5	UTSW	7	51537800	missense	probably damaging	0.97
R7808:Ano5	UTSW	7	51587795	missense	possibly damaging	0.53
R7840:Ano5	UTSW	7	51587732	missense	possibly damaging	0.88
R7886:Ano5	UTSW	7	51570393	missense	probably benign	0.12
R7975:Ano5	UTSW	7	51566538	missense	probably null	0.98
R8006:Ano5	UTSW	7	51593770	missense	probably benign	0.05
R8060:Ano5	UTSW	7	51587783	missense	probably benign	0.01
R8084:Ano5	UTSW	7	51579539	missense	probably benign	0.01
R8351:Ano5	UTSW	7	51553878	missense	probably benign	0.10
R8504:Ano5	UTSW	7	51573028	missense	probably benign	0.01
R8699:Ano5	UTSW	7	51593771	missense	probably benign
R8710:Ano5	UTSW	7	51593671	missense	probably damaging	1.00
R8752:Ano5	UTSW	7	51546869	missense	probably damaging	1.00
R8771:Ano5	UTSW	7	51566347	missense	probably damaging	0.99
R8771:Ano5	UTSW	7	51570299	nonsense	probably null
R8815:Ano5	UTSW	7	51544800	nonsense	probably null
R9057:Ano5	UTSW	7	51553906	missense	probably benign	0.05
R9118:Ano5	UTSW	7	51570374	missense	probably damaging	0.99
R9217:Ano5	UTSW	7	51593667	missense	probably damaging	1.00
R9462:Ano5	UTSW	7	51585452	missense	probably benign	0.19
R9699:Ano5	UTSW	7	51579561	missense	probably damaging	1.00
X0062:Ano5	UTSW	7	51593651	nonsense	probably null
X0065:Ano5	UTSW	7	51576628	nonsense	probably null
Z1176:Ano5	UTSW	7	51574703	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTGAGTCTAACACCTTGAAACAC -3'
(R):5'- TTGCAACAGAAACGATGGCC -3'

Sequencing Primer
(F):5'- TTGAAACACACACTGCCTCTC -3'
(R):5'- CATTCCAAAAAGAATGTCTTGCCAG -3'

Posted On

2017-02-10