Incidental Mutation 'R5856:Zfp703'
ID454911
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Namezinc finger protein 703
SynonymsZeppo1, End2, 1110032O19Rik, Csmn1
MMRRC Submission 043230-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5856 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26977325-26981461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26979205 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 299 (P299L)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P299L

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Meta Mutation Damage Score 0.5368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrf5 A G 17: 43,446,120 T497A probably benign Het
Ano5 T C 7: 51,585,326 I669T probably benign Het
Arhgap11a A T 2: 113,833,771 N722K possibly damaging Het
Atm A T 9: 53,495,955 I1161K possibly damaging Het
Atp13a4 T C 16: 29,433,987 T714A possibly damaging Het
BC051665 T A 13: 60,784,500 M92L probably benign Het
Car3 G A 3: 14,871,641 V255M probably damaging Het
Cnot11 C A 1: 39,537,453 F179L probably benign Het
Dctn1 A G 6: 83,197,865 Y1013C probably damaging Het
Gm19965 A G 1: 116,821,849 D420G probably benign Het
Gm5444 A G 13: 4,771,684 noncoding transcript Het
Hydin A T 8: 110,541,842 D2946V probably damaging Het
Hyou1 C T 9: 44,381,344 R119C probably damaging Het
Ighm A T 12: 113,421,602 L246Q unknown Het
Itpr3 A G 17: 27,106,405 E1324G probably damaging Het
Loxl4 G T 19: 42,595,366 Q749K possibly damaging Het
Muc2 C A 7: 141,745,644 probably benign Het
Myh11 T C 16: 14,205,976 T1505A probably benign Het
Nsmce2 A G 15: 59,378,943 E21G probably damaging Het
Olfr1220 T A 2: 89,097,910 I6F probably benign Het
Olfr273 T A 4: 52,856,516 probably benign Het
Plaa A G 4: 94,583,487 I375T probably benign Het
Pou2f1 C T 1: 165,915,130 A65T probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rxfp1 T A 3: 79,663,313 N271Y possibly damaging Het
Sema5b T G 16: 35,646,386 Y219* probably null Het
Slc35f3 G T 8: 126,321,080 R53L probably benign Het
Slc44a5 T C 3: 154,258,392 V465A possibly damaging Het
Slc9a5 A G 8: 105,357,165 I446V possibly damaging Het
Slf1 A T 13: 77,106,087 D204E possibly damaging Het
Sox5 T A 6: 144,209,362 T3S probably damaging Het
Srr G A 11: 74,913,012 R40C possibly damaging Het
Tas2r115 T A 6: 132,737,538 H150L possibly damaging Het
Tet2 A G 3: 133,486,640 S678P probably benign Het
Tmem11 T C 11: 60,864,858 K183E probably damaging Het
Upf1 T C 8: 70,334,762 probably null Het
Xpo6 A T 7: 126,149,502 probably benign Het
Zfp638 C T 6: 83,977,065 S1384L probably damaging Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 26980008 missense probably damaging 0.98
R1524:Zfp703 UTSW 8 26979373 missense probably damaging 1.00
R2082:Zfp703 UTSW 8 26978988 missense probably benign 0.01
R4049:Zfp703 UTSW 8 26979085 missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 26978953 missense probably benign 0.10
R4884:Zfp703 UTSW 8 26978701 missense probably benign 0.03
R4929:Zfp703 UTSW 8 26978851 missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 26979773 missense probably damaging 1.00
R4943:Zfp703 UTSW 8 26979591 missense probably benign 0.35
R5117:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5118:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5297:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5465:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5466:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5467:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5492:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5493:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5494:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5757:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5758:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5802:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5828:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5850:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5854:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5959:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R6464:Zfp703 UTSW 8 26979327 missense probably damaging 1.00
R6867:Zfp703 UTSW 8 26978640 missense probably damaging 0.97
R7067:Zfp703 UTSW 8 26979016 missense probably damaging 0.96
R7812:Zfp703 UTSW 8 26979878 missense probably damaging 1.00
R7880:Zfp703 UTSW 8 26978690 missense unknown
R8167:Zfp703 UTSW 8 26979754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCAGACTGCAAGAACGG -3'
(R):5'- TAGGGGTCACGGCATAATCC -3'

Sequencing Primer
(F):5'- CTGCAAGAACGGCGGCG -3'
(R):5'- GTCACGGCATAATCCCTGCAG -3'
Posted On2017-02-10