Incidental Mutation 'R5856:Zfp703'
ID 454911
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Name zinc finger protein 703
Synonyms Zeppo1, 1110032O19Rik, Csmn1, End2
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.364) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 27467364-27471490 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27469233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 299 (P299L)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
AlphaFold P0CL69
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P299L

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Meta Mutation Damage Score 0.5368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 27,470,036 (GRCm39) missense probably damaging 0.98
R1524:Zfp703 UTSW 8 27,469,401 (GRCm39) missense probably damaging 1.00
R2082:Zfp703 UTSW 8 27,469,016 (GRCm39) missense probably benign 0.01
R4049:Zfp703 UTSW 8 27,469,113 (GRCm39) missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 27,468,981 (GRCm39) missense probably benign 0.10
R4884:Zfp703 UTSW 8 27,468,729 (GRCm39) missense probably benign 0.03
R4929:Zfp703 UTSW 8 27,468,879 (GRCm39) missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 27,469,801 (GRCm39) missense probably damaging 1.00
R4943:Zfp703 UTSW 8 27,469,619 (GRCm39) missense probably benign 0.35
R5117:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5118:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5297:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5465:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5466:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5467:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5492:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5493:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5494:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5757:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5758:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5802:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5828:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5850:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5854:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R5959:Zfp703 UTSW 8 27,469,233 (GRCm39) missense probably damaging 1.00
R6464:Zfp703 UTSW 8 27,469,355 (GRCm39) missense probably damaging 1.00
R6867:Zfp703 UTSW 8 27,468,668 (GRCm39) missense probably damaging 0.97
R7067:Zfp703 UTSW 8 27,469,044 (GRCm39) missense probably damaging 0.96
R7812:Zfp703 UTSW 8 27,469,906 (GRCm39) missense probably damaging 1.00
R7880:Zfp703 UTSW 8 27,468,718 (GRCm39) missense unknown
R8167:Zfp703 UTSW 8 27,469,782 (GRCm39) missense probably damaging 1.00
R8966:Zfp703 UTSW 8 27,468,302 (GRCm39) missense possibly damaging 0.83
R9686:Zfp703 UTSW 8 27,469,044 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTCAGACTGCAAGAACGG -3'
(R):5'- TAGGGGTCACGGCATAATCC -3'

Sequencing Primer
(F):5'- CTGCAAGAACGGCGGCG -3'
(R):5'- GTCACGGCATAATCCCTGCAG -3'
Posted On 2017-02-10