Incidental Mutation 'R5856:Hyou1'
ID 454917
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms Grp170, Cab140, Orp150, 140 kDa, CBP-140
MMRRC Submission 043230-MU
Accession Numbers

Genbank: NM_021395; MGI: 108030

Essential gene? Essential (E-score: 1.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44379490-44392369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44381344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 119 (R119C)
Ref Sequence ENSEMBL: ENSMUSP00000123749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: R119C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: R119C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159473
AA Change: R68C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115
AA Change: R68C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: R119C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: R119C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: R119C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: R119C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably damaging
Transcript: ENSMUST00000162560
AA Change: R119C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115
AA Change: R119C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217019
AA Change: R119C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217460
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrf5 A G 17: 43,446,120 T497A probably benign Het
Ano5 T C 7: 51,585,326 I669T probably benign Het
Arhgap11a A T 2: 113,833,771 N722K possibly damaging Het
Atm A T 9: 53,495,955 I1161K possibly damaging Het
Atp13a4 T C 16: 29,433,987 T714A possibly damaging Het
BC051665 T A 13: 60,784,500 M92L probably benign Het
Car3 G A 3: 14,871,641 V255M probably damaging Het
Cnot11 C A 1: 39,537,453 F179L probably benign Het
Dctn1 A G 6: 83,197,865 Y1013C probably damaging Het
Gm19965 A G 1: 116,821,849 D420G probably benign Het
Gm5444 A G 13: 4,771,684 noncoding transcript Het
Hydin A T 8: 110,541,842 D2946V probably damaging Het
Ighm A T 12: 113,421,602 L246Q unknown Het
Itpr3 A G 17: 27,106,405 E1324G probably damaging Het
Loxl4 G T 19: 42,595,366 Q749K possibly damaging Het
Muc2 C A 7: 141,745,644 probably benign Het
Myh11 T C 16: 14,205,976 T1505A probably benign Het
Nsmce2 A G 15: 59,378,943 E21G probably damaging Het
Olfr1220 T A 2: 89,097,910 I6F probably benign Het
Olfr273 T A 4: 52,856,516 probably benign Het
Plaa A G 4: 94,583,487 I375T probably benign Het
Pou2f1 C T 1: 165,915,130 A65T probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rxfp1 T A 3: 79,663,313 N271Y possibly damaging Het
Sema5b T G 16: 35,646,386 Y219* probably null Het
Slc35f3 G T 8: 126,321,080 R53L probably benign Het
Slc44a5 T C 3: 154,258,392 V465A possibly damaging Het
Slc9a5 A G 8: 105,357,165 I446V possibly damaging Het
Slf1 A T 13: 77,106,087 D204E possibly damaging Het
Sox5 T A 6: 144,209,362 T3S probably damaging Het
Srr G A 11: 74,913,012 R40C possibly damaging Het
Tas2r115 T A 6: 132,737,538 H150L possibly damaging Het
Tet2 A G 3: 133,486,640 S678P probably benign Het
Tmem11 T C 11: 60,864,858 K183E probably damaging Het
Upf1 T C 8: 70,334,762 probably null Het
Xpo6 A T 7: 126,149,502 probably benign Het
Zfp638 C T 6: 83,977,065 S1384L probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44385146 missense probably benign 0.02
IGL01660:Hyou1 APN 9 44381117 missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44382012 missense probably benign 0.21
IGL01903:Hyou1 APN 9 44381141 splice site probably benign
IGL02636:Hyou1 APN 9 44381410 critical splice donor site probably null
IGL02806:Hyou1 APN 9 44388883 nonsense probably null
IGL03401:Hyou1 APN 9 44384909 missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44388058 missense probably benign
ANU74:Hyou1 UTSW 9 44381263 missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44384477 missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44390851 missense probably benign 0.26
R0408:Hyou1 UTSW 9 44384692 missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44389242 missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44384681 missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44388870 missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44389406 missense probably benign 0.02
R1803:Hyou1 UTSW 9 44384182 nonsense probably null
R2060:Hyou1 UTSW 9 44381552 missense probably benign 0.28
R2180:Hyou1 UTSW 9 44388019 missense probably benign 0.30
R2233:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R2235:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R3950:Hyou1 UTSW 9 44385227 missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44380615 splice site probably null
R4393:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44387121 intron probably benign
R5239:Hyou1 UTSW 9 44385263 missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44385249 missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44388926 critical splice donor site probably null
R6431:Hyou1 UTSW 9 44382025 critical splice donor site probably null
R6594:Hyou1 UTSW 9 44389322 missense probably benign
R6596:Hyou1 UTSW 9 44387755 missense probably benign 0.00
R6613:Hyou1 UTSW 9 44382498 missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44381134 critical splice donor site probably null
R6849:Hyou1 UTSW 9 44387264 missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44389409 missense probably benign 0.04
R7632:Hyou1 UTSW 9 44381136 splice site probably null
R7711:Hyou1 UTSW 9 44384462 missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44385585 missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44388133 missense probably benign 0.26
R9352:Hyou1 UTSW 9 44389629 critical splice donor site probably null
R9385:Hyou1 UTSW 9 44381515 missense probably benign 0.06
X0027:Hyou1 UTSW 9 44390856 missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44387742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATTCGTTCCCTCAGAGGC -3'
(R):5'- TAGTTCAGAACCATGCCCAG -3'

Sequencing Primer
(F):5'- CTAGCCTTTTATCTAGCTGGATGAAG -3'
(R):5'- AGAGAACTGCAGCTGCCTG -3'
Posted On 2017-02-10