Incidental Mutation 'R5856:Srr'
ID 454921
Institutional Source Beutler Lab
Gene Symbol Srr
Ensembl Gene ENSMUSG00000001323
Gene Name serine racemase
Synonyms Rgsc34, M100034
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 74797185-74816774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74803838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 40 (R40C)
Ref Sequence ENSEMBL: ENSMUSP00000120012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000138612] [ENSMUST00000128556] [ENSMUST00000153316] [ENSMUST00000128230]
AlphaFold Q9QZX7
Predicted Effect probably benign
Transcript: ENSMUST00000045807
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065211
AA Change: R40C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108447
AA Change: R40C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108448
AA Change: R40C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121738
AA Change: R40C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
AA Change: R40C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138612
AA Change: R40C

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147817
Predicted Effect possibly damaging
Transcript: ENSMUST00000128556
AA Change: R40C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323
AA Change: R40C

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130910
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased D-serine levels in the cerebral cortex and hippocampus, and neuronal damage associated with NMDA excitotoxicity and beta-amyloid peptide 1-42 exposure is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Slf1 A T 13: 77,254,206 (GRCm39) D204E possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Srr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02949:Srr APN 11 74,799,563 (GRCm39) missense probably benign 0.00
IGL03268:Srr APN 11 74,803,943 (GRCm39) missense probably benign 0.06
PIT4382001:Srr UTSW 11 74,801,134 (GRCm39) missense probably benign 0.42
R0718:Srr UTSW 11 74,801,891 (GRCm39) missense possibly damaging 0.74
R1588:Srr UTSW 11 74,799,629 (GRCm39) missense possibly damaging 0.93
R1960:Srr UTSW 11 74,799,542 (GRCm39) missense probably damaging 1.00
R1986:Srr UTSW 11 74,799,545 (GRCm39) missense probably damaging 1.00
R4043:Srr UTSW 11 74,799,947 (GRCm39) missense probably benign 0.08
R4112:Srr UTSW 11 74,803,898 (GRCm39) missense probably benign
R4877:Srr UTSW 11 74,798,606 (GRCm39) unclassified probably benign
R5959:Srr UTSW 11 74,801,891 (GRCm39) missense possibly damaging 0.74
R6362:Srr UTSW 11 74,801,028 (GRCm39) missense probably damaging 1.00
R7163:Srr UTSW 11 74,803,828 (GRCm39) missense probably damaging 0.96
R7706:Srr UTSW 11 74,803,961 (GRCm39) critical splice acceptor site probably null
R7817:Srr UTSW 11 74,799,524 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCATAGCAATGTTGTAAACCTGG -3'
(R):5'- GCCATTGTCCTGTTTCAGCG -3'

Sequencing Primer
(F):5'- GGTACCCTCATCTTCAAAATTGTG -3'
(R):5'- CATTGTCCTGTTTCAGCGTTTTAAAG -3'
Posted On 2017-02-10