Incidental Mutation 'R5856:Slf1'
ID 454925
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene Name SMC5-SMC6 complex localization factor 1
Synonyms 2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 77043088-77135473 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77106087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 204 (D204E)
Ref Sequence ENSEMBL: ENSMUSP00000124865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
AlphaFold Q8R3P9
Predicted Effect probably benign
Transcript: ENSMUST00000151524
AA Change: D204E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: D204E

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159300
AA Change: D204E

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597
AA Change: D204E

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159462
AA Change: D210E

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597
AA Change: D210E

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect probably benign
Transcript: ENSMUST00000162921
AA Change: M150K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597
AA Change: M150K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162944
AA Change: M150K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597
AA Change: M150K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrf5 A G 17: 43,446,120 T497A probably benign Het
Ano5 T C 7: 51,585,326 I669T probably benign Het
Arhgap11a A T 2: 113,833,771 N722K possibly damaging Het
Atm A T 9: 53,495,955 I1161K possibly damaging Het
Atp13a4 T C 16: 29,433,987 T714A possibly damaging Het
BC051665 T A 13: 60,784,500 M92L probably benign Het
Car3 G A 3: 14,871,641 V255M probably damaging Het
Cnot11 C A 1: 39,537,453 F179L probably benign Het
Dctn1 A G 6: 83,197,865 Y1013C probably damaging Het
Gm19965 A G 1: 116,821,849 D420G probably benign Het
Gm5444 A G 13: 4,771,684 noncoding transcript Het
Hydin A T 8: 110,541,842 D2946V probably damaging Het
Hyou1 C T 9: 44,381,344 R119C probably damaging Het
Ighm A T 12: 113,421,602 L246Q unknown Het
Itpr3 A G 17: 27,106,405 E1324G probably damaging Het
Loxl4 G T 19: 42,595,366 Q749K possibly damaging Het
Muc2 C A 7: 141,745,644 probably benign Het
Myh11 T C 16: 14,205,976 T1505A probably benign Het
Nsmce2 A G 15: 59,378,943 E21G probably damaging Het
Olfr1220 T A 2: 89,097,910 I6F probably benign Het
Olfr273 T A 4: 52,856,516 probably benign Het
Plaa A G 4: 94,583,487 I375T probably benign Het
Pou2f1 C T 1: 165,915,130 A65T probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rxfp1 T A 3: 79,663,313 N271Y possibly damaging Het
Sema5b T G 16: 35,646,386 Y219* probably null Het
Slc35f3 G T 8: 126,321,080 R53L probably benign Het
Slc44a5 T C 3: 154,258,392 V465A possibly damaging Het
Slc9a5 A G 8: 105,357,165 I446V possibly damaging Het
Sox5 T A 6: 144,209,362 T3S probably damaging Het
Srr G A 11: 74,913,012 R40C possibly damaging Het
Tas2r115 T A 6: 132,737,538 H150L possibly damaging Het
Tet2 A G 3: 133,486,640 S678P probably benign Het
Tmem11 T C 11: 60,864,858 K183E probably damaging Het
Upf1 T C 8: 70,334,762 probably null Het
Xpo6 A T 7: 126,149,502 probably benign Het
Zfp638 C T 6: 83,977,065 S1384L probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 splice site probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
R7807:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R8175:Slf1 UTSW 13 77112671 missense probably damaging 1.00
R8385:Slf1 UTSW 13 77105990 missense probably benign
R8698:Slf1 UTSW 13 77049165 missense possibly damaging 0.78
R8770:Slf1 UTSW 13 77046647 missense probably damaging 1.00
R8786:Slf1 UTSW 13 77126687 missense possibly damaging 0.93
R8796:Slf1 UTSW 13 77066665 missense probably benign 0.00
R8932:Slf1 UTSW 13 77046574 missense probably damaging 1.00
R9132:Slf1 UTSW 13 77100954 missense probably benign 0.24
R9243:Slf1 UTSW 13 77125456 missense possibly damaging 0.95
R9274:Slf1 UTSW 13 77043550 makesense probably null
R9286:Slf1 UTSW 13 77043813 missense probably damaging 0.99
R9416:Slf1 UTSW 13 77046537 missense
R9612:Slf1 UTSW 13 77049085 critical splice donor site probably null
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCTAGCTTTCAGACCTG -3'
(R):5'- GCCTATTGCAGTATTTTACCAGTG -3'

Sequencing Primer
(F):5'- AGAACAGGCTCTCTTCTATAATTCTC -3'
(R):5'- GCAGTATTTTACCAGTGTTTAGTAGC -3'
Posted On 2017-02-10