Incidental Mutation 'R5856:Slf1'
ID 454925
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene Name SMC5-SMC6 complex localization factor 1
Synonyms Brctx, C730024G01Rik, Ankrd32, Brctd1, 2700017A04Rik
MMRRC Submission 043230-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5856 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 77191207-77283592 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77254206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 204 (D204E)
Ref Sequence ENSEMBL: ENSMUSP00000124865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
AlphaFold Q8R3P9
Predicted Effect probably benign
Transcript: ENSMUST00000151524
AA Change: D204E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: D204E

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159300
AA Change: D204E

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597
AA Change: D204E

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159462
AA Change: D210E

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597
AA Change: D210E

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect probably benign
Transcript: ENSMUST00000162921
AA Change: M150K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597
AA Change: M150K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162944
AA Change: M150K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597
AA Change: M150K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Adgrf5 A G 17: 43,757,011 (GRCm39) T497A probably benign Het
Ano5 T C 7: 51,235,074 (GRCm39) I669T probably benign Het
Arhgap11a A T 2: 113,664,116 (GRCm39) N722K possibly damaging Het
Atm A T 9: 53,407,255 (GRCm39) I1161K possibly damaging Het
Atp13a4 T C 16: 29,252,805 (GRCm39) T714A possibly damaging Het
BC051665 T A 13: 60,932,314 (GRCm39) M92L probably benign Het
Car3 G A 3: 14,936,701 (GRCm39) V255M probably damaging Het
Cnot11 C A 1: 39,576,534 (GRCm39) F179L probably benign Het
Dctn1 A G 6: 83,174,847 (GRCm39) Y1013C probably damaging Het
Gm19965 A G 1: 116,749,579 (GRCm39) D420G probably benign Het
Gm5444 A G 13: 4,821,683 (GRCm39) noncoding transcript Het
Hydin A T 8: 111,268,474 (GRCm39) D2946V probably damaging Het
Hyou1 C T 9: 44,292,641 (GRCm39) R119C probably damaging Het
Ighm A T 12: 113,385,222 (GRCm39) L246Q unknown Het
Itpr3 A G 17: 27,325,379 (GRCm39) E1324G probably damaging Het
Loxl4 G T 19: 42,583,805 (GRCm39) Q749K possibly damaging Het
Muc2 C A 7: 141,299,381 (GRCm39) probably benign Het
Myh11 T C 16: 14,023,840 (GRCm39) T1505A probably benign Het
Nsmce2 A G 15: 59,250,792 (GRCm39) E21G probably damaging Het
Or13c3 T A 4: 52,856,516 (GRCm39) probably benign Het
Or4c115 T A 2: 88,928,254 (GRCm39) I6F probably benign Het
Plaa A G 4: 94,471,724 (GRCm39) I375T probably benign Het
Pou2f1 C T 1: 165,742,699 (GRCm39) A65T probably benign Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rxfp1 T A 3: 79,570,620 (GRCm39) N271Y possibly damaging Het
Sema5b T G 16: 35,466,756 (GRCm39) Y219* probably null Het
Slc35f3 G T 8: 127,047,819 (GRCm39) R53L probably benign Het
Slc44a5 T C 3: 153,964,029 (GRCm39) V465A possibly damaging Het
Slc9a5 A G 8: 106,083,797 (GRCm39) I446V possibly damaging Het
Sox5 T A 6: 144,155,088 (GRCm39) T3S probably damaging Het
Srr G A 11: 74,803,838 (GRCm39) R40C possibly damaging Het
Tas2r115 T A 6: 132,714,501 (GRCm39) H150L possibly damaging Het
Tet2 A G 3: 133,192,401 (GRCm39) S678P probably benign Het
Tmem11 T C 11: 60,755,684 (GRCm39) K183E probably damaging Het
Upf1 T C 8: 70,787,412 (GRCm39) probably null Het
Xpo6 A T 7: 125,748,674 (GRCm39) probably benign Het
Zfp638 C T 6: 83,954,047 (GRCm39) S1384L probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77,192,066 (GRCm39) missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77,249,031 (GRCm39) unclassified probably benign
IGL01108:Slf1 APN 13 77,273,594 (GRCm39) splice site probably benign
IGL01149:Slf1 APN 13 77,260,767 (GRCm39) missense probably damaging 0.99
IGL01642:Slf1 APN 13 77,198,034 (GRCm39) missense probably benign 0.00
IGL01757:Slf1 APN 13 77,232,559 (GRCm39) missense probably benign
IGL01887:Slf1 APN 13 77,249,101 (GRCm39) missense probably benign 0.02
IGL02323:Slf1 APN 13 77,199,413 (GRCm39) missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77,274,478 (GRCm39) splice site probably benign
IGL02971:Slf1 APN 13 77,195,223 (GRCm39) splice site probably benign
IGL03088:Slf1 APN 13 77,232,554 (GRCm39) missense probably damaging 1.00
IGL03215:Slf1 APN 13 77,198,096 (GRCm39) missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77,192,123 (GRCm39) missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77,198,169 (GRCm39) splice site probably benign
R0036:Slf1 UTSW 13 77,249,070 (GRCm39) missense probably benign 0.02
R0036:Slf1 UTSW 13 77,249,070 (GRCm39) missense probably benign 0.02
R0125:Slf1 UTSW 13 77,191,864 (GRCm39) missense probably benign 0.02
R0230:Slf1 UTSW 13 77,260,867 (GRCm39) intron probably benign
R0244:Slf1 UTSW 13 77,274,751 (GRCm39) nonsense probably null
R0395:Slf1 UTSW 13 77,254,088 (GRCm39) splice site probably benign
R0614:Slf1 UTSW 13 77,197,233 (GRCm39) missense probably benign 0.10
R0661:Slf1 UTSW 13 77,231,715 (GRCm39) missense probably benign 0.31
R0837:Slf1 UTSW 13 77,249,067 (GRCm39) splice site probably null
R0945:Slf1 UTSW 13 77,251,590 (GRCm39) unclassified probably benign
R1282:Slf1 UTSW 13 77,191,959 (GRCm39) missense probably damaging 0.97
R1365:Slf1 UTSW 13 77,274,490 (GRCm39) missense probably damaging 1.00
R1449:Slf1 UTSW 13 77,231,568 (GRCm39) missense probably damaging 1.00
R1646:Slf1 UTSW 13 77,214,767 (GRCm39) nonsense probably null
R2071:Slf1 UTSW 13 77,252,743 (GRCm39) missense probably benign 0.02
R2141:Slf1 UTSW 13 77,197,338 (GRCm39) critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77,194,825 (GRCm39) critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77,251,702 (GRCm39) nonsense probably null
R2520:Slf1 UTSW 13 77,199,384 (GRCm39) missense probably damaging 1.00
R3108:Slf1 UTSW 13 77,274,840 (GRCm39) splice site probably benign
R4178:Slf1 UTSW 13 77,191,688 (GRCm39) missense probably damaging 1.00
R4663:Slf1 UTSW 13 77,274,723 (GRCm39) missense probably damaging 1.00
R4730:Slf1 UTSW 13 77,194,751 (GRCm39) missense probably damaging 1.00
R4910:Slf1 UTSW 13 77,191,999 (GRCm39) missense probably benign 0.14
R4912:Slf1 UTSW 13 77,199,413 (GRCm39) missense probably damaging 1.00
R5122:Slf1 UTSW 13 77,198,106 (GRCm39) missense probably benign 0.01
R5269:Slf1 UTSW 13 77,252,700 (GRCm39) missense probably benign 0.33
R5336:Slf1 UTSW 13 77,254,129 (GRCm39) makesense probably null
R5346:Slf1 UTSW 13 77,240,490 (GRCm39) missense probably benign 0.00
R5445:Slf1 UTSW 13 77,239,323 (GRCm39) missense probably benign 0.10
R5568:Slf1 UTSW 13 77,194,823 (GRCm39) missense probably damaging 1.00
R5622:Slf1 UTSW 13 77,198,090 (GRCm39) missense probably benign 0.14
R5685:Slf1 UTSW 13 77,231,598 (GRCm39) missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77,214,856 (GRCm39) missense probably benign 0.03
R6109:Slf1 UTSW 13 77,274,799 (GRCm39) missense probably damaging 0.99
R6245:Slf1 UTSW 13 77,232,502 (GRCm39) missense probably damaging 1.00
R6338:Slf1 UTSW 13 77,232,581 (GRCm39) critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77,214,725 (GRCm39) missense probably damaging 1.00
R6487:Slf1 UTSW 13 77,214,736 (GRCm39) missense probably damaging 1.00
R6597:Slf1 UTSW 13 77,197,248 (GRCm39) missense probably benign 0.01
R6600:Slf1 UTSW 13 77,231,655 (GRCm39) missense probably benign 0.00
R6661:Slf1 UTSW 13 77,191,964 (GRCm39) missense probably damaging 1.00
R7268:Slf1 UTSW 13 77,214,826 (GRCm39) missense probably damaging 1.00
R7308:Slf1 UTSW 13 77,199,287 (GRCm39) missense probably benign 0.19
R7355:Slf1 UTSW 13 77,239,422 (GRCm39) missense probably damaging 1.00
R7546:Slf1 UTSW 13 77,197,311 (GRCm39) missense probably benign
R7807:Slf1 UTSW 13 77,194,823 (GRCm39) missense probably damaging 1.00
R8175:Slf1 UTSW 13 77,260,790 (GRCm39) missense probably damaging 1.00
R8385:Slf1 UTSW 13 77,254,109 (GRCm39) missense probably benign
R8698:Slf1 UTSW 13 77,197,284 (GRCm39) missense possibly damaging 0.78
R8770:Slf1 UTSW 13 77,194,766 (GRCm39) missense probably damaging 1.00
R8786:Slf1 UTSW 13 77,274,806 (GRCm39) missense possibly damaging 0.93
R8796:Slf1 UTSW 13 77,214,784 (GRCm39) missense probably benign 0.00
R8932:Slf1 UTSW 13 77,194,693 (GRCm39) missense probably damaging 1.00
R9132:Slf1 UTSW 13 77,249,073 (GRCm39) missense probably benign 0.24
R9243:Slf1 UTSW 13 77,273,575 (GRCm39) missense possibly damaging 0.95
R9274:Slf1 UTSW 13 77,191,669 (GRCm39) makesense probably null
R9286:Slf1 UTSW 13 77,191,932 (GRCm39) missense probably damaging 0.99
R9416:Slf1 UTSW 13 77,194,656 (GRCm39) missense
R9612:Slf1 UTSW 13 77,197,204 (GRCm39) critical splice donor site probably null
X0018:Slf1 UTSW 13 77,199,357 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCTAGCTTTCAGACCTG -3'
(R):5'- GCCTATTGCAGTATTTTACCAGTG -3'

Sequencing Primer
(F):5'- AGAACAGGCTCTCTTCTATAATTCTC -3'
(R):5'- GCAGTATTTTACCAGTGTTTAGTAGC -3'
Posted On 2017-02-10