Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Adgrf5'

454931

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5856 (G1)

Quality Score

209

Status

Not validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43446120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 497 (T497A)

Ref Sequence

ENSEMBL: ENSMUSP00000153373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225004] [ENSMUST00000225962] [ENSMUST00000226087]

AlphaFold

G5E8Q8

Predicted Effect

probably benign
Transcript: ENSMUST00000113599
AA Change: T702A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: T702A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225004

Predicted Effect

probably benign
Transcript: ENSMUST00000225962
AA Change: T497A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000226087
AA Change: T702A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
goop	UTSW	17	43441969	missense	probably damaging	0.99
Heaped	UTSW	17	43447036	missense	possibly damaging	0.93
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
noel	UTSW	17	43430612	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4616:Adgrf5	UTSW	17	43452440	missense	probably benign	0.38
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R4645:Adgrf5	UTSW	17	43437525	missense	probably damaging	1.00
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6602:Adgrf5	UTSW	17	43450304	missense	probably benign	0.32
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7717:Adgrf5	UTSW	17	43450753	missense	probably damaging	1.00
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7950:Adgrf5	UTSW	17	43451157	missense	probably damaging	0.99
R7988:Adgrf5	UTSW	17	43439813	intron	probably benign
R8188:Adgrf5	UTSW	17	43430612	missense	probably damaging	1.00
R8219:Adgrf5	UTSW	17	43449859	missense	probably benign	0.13
R8284:Adgrf5	UTSW	17	43455270	missense	unknown
R8460:Adgrf5	UTSW	17	43439808	intron	probably benign
R8504:Adgrf5	UTSW	17	43446949	missense	probably benign	0.01
R8751:Adgrf5	UTSW	17	43437683	missense	possibly damaging	0.80
R8852:Adgrf5	UTSW	17	43453098	missense	possibly damaging	0.82
R9196:Adgrf5	UTSW	17	43445104	missense	possibly damaging	0.94
R9418:Adgrf5	UTSW	17	43426973	missense	probably benign	0.00
R9671:Adgrf5	UTSW	17	43449904	missense	probably damaging	1.00
R9734:Adgrf5	UTSW	17	43452308	missense	probably damaging	1.00
R9756:Adgrf5	UTSW	17	43450246	missense	probably benign	0.01
R9765:Adgrf5	UTSW	17	43437600	missense	probably damaging	1.00
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00
Z1191:Adgrf5	UTSW	17	43445035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCATGTCCTTAAGACCTTCGG -3'
(R):5'- TCTCCTAAGGGCTGAGAATCCTG -3'

Sequencing Primer
(F):5'- GTCCTTAAGACCTTCGGTAAGCAG -3'
(R):5'- TGAGAATCCTGCTGAGCCAG -3'

Posted On

2017-02-10