Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Loxl4'

454933

Institutional Source

Beutler Lab

Gene Symbol

Loxl4

Ensembl Gene

ENSMUSG00000025185

Gene Name

lysyl oxidase-like 4

Synonyms

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5856 (G1)

Quality Score

144

Status

Not validated

Chromosome

Chromosomal Location

42593982-42612813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 42595366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 749 (Q749K)

Ref Sequence

ENSEMBL: ENSMUSP00000125803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026188] [ENSMUST00000026190] [ENSMUST00000160107] [ENSMUST00000164786] [ENSMUST00000171432]

AlphaFold

Q924C6

Predicted Effect

probably benign
Transcript: ENSMUST00000026188

SMART Domains

Protein: ENSMUSP00000026188
Gene: ENSMUSG00000025184

Domain	Start	End	E-Value	Type
low complexity region	163	178	N/A	INTRINSIC
low complexity region	694	706	N/A	INTRINSIC
coiled coil region	734	766	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000026190
AA Change: Q748K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: Q748K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SR	33	134	1.57e-49	SMART
SR	160	288	3.96e-14	SMART
SR	312	412	2.6e-41	SMART
SR	422	530	5.41e-30	SMART
Pfam:Lysyl_oxidase	534	737	1.3e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160107

SMART Domains

Protein: ENSMUSP00000124036
Gene: ENSMUSG00000025184

Domain	Start	End	E-Value	Type
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	154	186	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164786
AA Change: Q749K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: Q749K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SR	33	134	1.57e-49	SMART
SR	160	288	3.96e-14	SMART
SR	313	413	2.6e-41	SMART
SR	423	531	5.41e-30	SMART
Pfam:Lysyl_oxidase	535	735	1.8e-101	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171432
AA Change: Q748K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: Q748K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SR	33	134	1.57e-49	SMART
SR	160	288	3.96e-14	SMART
SR	312	412	2.6e-41	SMART
SR	422	530	5.41e-30	SMART
Pfam:Lysyl_oxidase	534	737	1.3e-113	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Sema5b	T	G	16: 35,646,386	Y219*	probably null	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Loxl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Loxl4	APN	19	42597549	missense	probably damaging	1.00
IGL02063:Loxl4	APN	19	42608339	missense	probably benign	0.03
IGL02490:Loxl4	APN	19	42604830	missense	probably benign
IGL02498:Loxl4	APN	19	42604973	missense	probably benign	0.27
IGL03107:Loxl4	APN	19	42605279	missense	probably benign	0.12
IGL03296:Loxl4	APN	19	42598823	splice site	probably benign
R1145:Loxl4	UTSW	19	42608555	unclassified	probably benign
R1697:Loxl4	UTSW	19	42604940	missense	possibly damaging	0.86
R2126:Loxl4	UTSW	19	42603963	missense	probably damaging	1.00
R2128:Loxl4	UTSW	19	42603963	missense	probably damaging	1.00
R2148:Loxl4	UTSW	19	42604192	splice site	probably null
R2159:Loxl4	UTSW	19	42600007	missense	probably damaging	1.00
R3624:Loxl4	UTSW	19	42607576	missense	probably benign	0.28
R4030:Loxl4	UTSW	19	42608359	missense	probably damaging	1.00
R4181:Loxl4	UTSW	19	42607591	missense	probably benign	0.00
R4302:Loxl4	UTSW	19	42607591	missense	probably benign	0.00
R4700:Loxl4	UTSW	19	42607613	missense	probably benign	0.07
R4701:Loxl4	UTSW	19	42607613	missense	probably benign	0.07
R4719:Loxl4	UTSW	19	42607591	missense	probably benign	0.00
R4724:Loxl4	UTSW	19	42608346	missense	probably benign	0.23
R4750:Loxl4	UTSW	19	42605004	missense	probably damaging	1.00
R4953:Loxl4	UTSW	19	42610694	unclassified	probably benign
R5579:Loxl4	UTSW	19	42604290	missense	probably damaging	1.00
R5840:Loxl4	UTSW	19	42598715	missense	probably damaging	1.00
R5879:Loxl4	UTSW	19	42607627	missense	probably benign	0.09
R6137:Loxl4	UTSW	19	42598793	missense	probably damaging	1.00
R6180:Loxl4	UTSW	19	42608352	missense	probably damaging	1.00
R6324:Loxl4	UTSW	19	42595378	missense	probably benign	0.00
R6347:Loxl4	UTSW	19	42608270	missense	probably damaging	1.00
R6646:Loxl4	UTSW	19	42598781	missense	probably damaging	1.00
R6788:Loxl4	UTSW	19	42608353	missense	probably damaging	1.00
R7045:Loxl4	UTSW	19	42606635	missense	probably damaging	1.00
R8013:Loxl4	UTSW	19	42607676	missense	probably damaging	1.00
R8072:Loxl4	UTSW	19	42607582	missense	probably damaging	1.00
R8546:Loxl4	UTSW	19	42607588	missense	probably benign
R9124:Loxl4	UTSW	19	42607660	missense	probably damaging	1.00
R9202:Loxl4	UTSW	19	42605013	missense	probably benign	0.00
R9286:Loxl4	UTSW	19	42597608	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GTGATGATCTGGCCACCGAAAG -3'
(R):5'- ACTTACCAGGTGGAAACCAGG -3'

Sequencing Primer
(F):5'- AAAGGCCTCCTGAGCAGCTTC -3'
(R):5'- CCAGGGGACAAGCCAGGTAG -3'

Posted On

2017-02-10