Mutagenetix > Incidental Mutation

Incidental Mutation 'R5857:Ctnnbl1'

454939

Institutional Source

Beutler Lab

Gene Symbol

Ctnnbl1

Ensembl Gene

ENSMUSG00000027649

Gene Name

catenin, beta like 1

Synonyms

P14L, FLJ21108, NYD-SP19, 5730471K09Rik

MMRRC Submission

044069-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R5857 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

157737401-157891614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157789098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 145 (S145P)

Ref Sequence

ENSEMBL: ENSMUSP00000029178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029178]

AlphaFold

Q9CWL8

Predicted Effect

probably damaging
Transcript: ENSMUST00000029178
AA Change: S145P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: S145P

Domain	Start	End	E-Value	Type
DUF1716	52	162	3.97e-61	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156300

Meta Mutation Damage Score

0.9106

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,449,525	I266V	probably benign	Het
Anks6	C	T	4: 47,039,736	A492T	possibly damaging	Het
Ano1	A	T	7: 144,637,103	C415S	probably benign	Het
Anxa3	T	A	5: 96,828,792		probably null	Het
Apob	T	C	12: 8,015,397	V4089A	probably benign	Het
Arhgap23	C	T	11: 97,451,579	A229V	possibly damaging	Het
Atad5	T	C	11: 80,131,329	F1447L	probably benign	Het
Btbd8	T	A	5: 107,461,532	D212E	probably damaging	Het
Ccdc38	G	T	10: 93,562,833	A58S	possibly damaging	Het
Cep112	T	C	11: 108,531,471		probably benign	Het
Col4a2	G	A	8: 11,425,442	G622D	probably damaging	Het
Crhbp	T	A	13: 95,442,232	Q134L	probably benign	Het
Cyp4f16	T	A	17: 32,537,024	L9Q	probably damaging	Het
Dchs2	T	G	3: 83,270,313	I891S	possibly damaging	Het
Disp3	A	T	4: 148,249,183	V1066D	probably benign	Het
Dlgap1	A	G	17: 70,815,393		probably benign	Het
Dnah3	TTCCTC	TTC	7: 119,951,021		probably benign	Het
Efl1	T	A	7: 82,763,189	C929S	probably benign	Het
Fam129b	T	A	2: 32,909,908	N82K	probably benign	Het
Gatb	T	C	3: 85,575,932	F82S	probably damaging	Het
Gk5	C	A	9: 96,119,455	S2*	probably null	Het
Gpr135	G	A	12: 72,070,840	A51V	probably benign	Het
Hoxa9	T	A	6: 52,224,297	N255Y	probably damaging	Het
Igkv8-18	T	C	6: 70,355,920	V15A	probably benign	Het
Ism2	T	C	12: 87,280,061	D368G	probably damaging	Het
Krtap6-2	A	T	16: 89,419,642	S146T	unknown	Het
Lama1	T	A	17: 67,807,843	L2329H	probably damaging	Het
Llgl2	T	A	11: 115,850,281	I507N	probably damaging	Het
Lmna	GCTGCCCACAC	GC	3: 88,482,531		probably benign	Het
Lrfn3	A	T	7: 30,359,438	I454N	possibly damaging	Het
Mdn1	C	A	4: 32,670,646	T437K	probably benign	Het
Nat8f3	T	C	6: 85,761,753	Y9C	probably damaging	Het
Nlrp4d	C	A	7: 10,382,377	G156V	noncoding transcript	Het
Npnt	A	T	3: 132,908,349	C167S	probably damaging	Het
Nr3c2	A	G	8: 76,908,867	N199S	possibly damaging	Het
Olfr248	T	G	1: 174,391,108	I13R	possibly damaging	Het
Olfr870	C	T	9: 20,171,239	D111N	probably damaging	Het
Olfr884	T	G	9: 38,047,753	V177G	probably benign	Het
Pabpc1l	T	A	2: 164,044,255		probably null	Het
Pi4ka	A	G	16: 17,358,984	I366T	probably benign	Het
Prl7a1	A	T	13: 27,640,701	D50E	probably damaging	Het
Rad52	T	G	6: 119,911,007		probably null	Het
Rbm19	T	A	5: 120,132,942	L610Q	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Scube1	G	T	15: 83,607,260		probably benign	Het
Sptbn4	G	T	7: 27,418,713	R314S	possibly damaging	Het
Togaram1	T	A	12: 64,995,557	I1130K	possibly damaging	Het
Tsc2	T	C	17: 24,600,007	E1352G	probably damaging	Het
Ube2d2a	A	G	18: 35,805,543	T142A	probably benign	Het
Vps18	T	C	2: 119,297,533	Y946H	probably damaging	Het

Other mutations in Ctnnbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ctnnbl1	APN	2	157819541	missense	possibly damaging	0.80
IGL01374:Ctnnbl1	APN	2	157836693	critical splice donor site	probably null
IGL01504:Ctnnbl1	APN	2	157818116	splice site	probably benign
IGL01622:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL01623:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL02146:Ctnnbl1	APN	2	157819494	missense	probably damaging	1.00
IGL02550:Ctnnbl1	APN	2	157884135	missense	probably benign	0.00
IGL03104:Ctnnbl1	APN	2	157890965	missense	probably damaging	0.99
IGL03164:Ctnnbl1	APN	2	157817761	missense	probably benign
R0482:Ctnnbl1	UTSW	2	157871190	critical splice donor site	probably null
R0826:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0827:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0862:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0863:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0864:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1466:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1533:Ctnnbl1	UTSW	2	157836643	missense	probably benign
R2971:Ctnnbl1	UTSW	2	157871186	missense	probably benign	0.06
R3522:Ctnnbl1	UTSW	2	157871193	splice site	probably null
R4296:Ctnnbl1	UTSW	2	157819570	splice site	probably null
R4982:Ctnnbl1	UTSW	2	157836553	missense	probably benign	0.01
R5396:Ctnnbl1	UTSW	2	157817832	splice site	probably null
R7710:Ctnnbl1	UTSW	2	157774571	missense	probably benign	0.00
R7769:Ctnnbl1	UTSW	2	157737470	start gained	probably benign
R8134:Ctnnbl1	UTSW	2	157809471	missense	probably benign	0.19
R8324:Ctnnbl1	UTSW	2	157779815	missense	probably damaging	0.97
R8384:Ctnnbl1	UTSW	2	157818060	missense	probably benign	0.01
R8430:Ctnnbl1	UTSW	2	157836683	missense	probably damaging	0.99
R9116:Ctnnbl1	UTSW	2	157806703	missense	probably damaging	1.00
R9244:Ctnnbl1	UTSW	2	157836663	missense	possibly damaging	0.63
R9350:Ctnnbl1	UTSW	2	157809525	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTCTGCTGTCGACATTTTGAC -3'
(R):5'- TAAGGCTCAGGCGTTCATGAG -3'

Sequencing Primer
(F):5'- TGTCGACATTTTGACAGATTGTG -3'
(R):5'- CTCAGGCGTTCATGAGTAAAGAGC -3'

Posted On

2017-02-10