Incidental Mutation 'R5857:Ctnnbl1'
ID454939
Institutional Source Beutler Lab
Gene Symbol Ctnnbl1
Ensembl Gene ENSMUSG00000027649
Gene Namecatenin, beta like 1
SynonymsP14L, FLJ21108, NYD-SP19, 5730471K09Rik
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5857 (G1)
Quality Score200
Status Validated
Chromosome2
Chromosomal Location157737401-157891614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157789098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000029178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029178]
Predicted Effect probably damaging
Transcript: ENSMUST00000029178
AA Change: S145P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: S145P

DomainStartEndE-ValueType
DUF1716 52 162 3.97e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156300
Meta Mutation Damage Score 0.9106 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Ctnnbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ctnnbl1 APN 2 157819541 missense possibly damaging 0.80
IGL01374:Ctnnbl1 APN 2 157836693 critical splice donor site probably null
IGL01504:Ctnnbl1 APN 2 157818116 splice site probably benign
IGL01622:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL01623:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL02146:Ctnnbl1 APN 2 157819494 missense probably damaging 1.00
IGL02550:Ctnnbl1 APN 2 157884135 missense probably benign 0.00
IGL03104:Ctnnbl1 APN 2 157890965 missense probably damaging 0.99
IGL03164:Ctnnbl1 APN 2 157817761 missense probably benign
R0482:Ctnnbl1 UTSW 2 157871190 critical splice donor site probably null
R0826:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0827:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0862:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0863:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0864:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1466:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1533:Ctnnbl1 UTSW 2 157836643 missense probably benign
R2971:Ctnnbl1 UTSW 2 157871186 missense probably benign 0.06
R3522:Ctnnbl1 UTSW 2 157871193 splice site probably null
R4296:Ctnnbl1 UTSW 2 157819570 synonymous probably null
R4982:Ctnnbl1 UTSW 2 157836553 missense probably benign 0.01
R5396:Ctnnbl1 UTSW 2 157817832 splice site probably null
R7710:Ctnnbl1 UTSW 2 157774571 missense probably benign 0.00
R7769:Ctnnbl1 UTSW 2 157737470 start gained probably benign
R8134:Ctnnbl1 UTSW 2 157809471 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTCTGCTGTCGACATTTTGAC -3'
(R):5'- TAAGGCTCAGGCGTTCATGAG -3'

Sequencing Primer
(F):5'- TGTCGACATTTTGACAGATTGTG -3'
(R):5'- CTCAGGCGTTCATGAGTAAAGAGC -3'
Posted On2017-02-10