Incidental Mutation 'R5857:Lmna'
ID454943
Institutional Source Beutler Lab
Gene Symbol Lmna
Ensembl Gene ENSMUSG00000028063
Gene Namelamin A
SynonymsDhe, lamin A/C
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5857 (G1)
Quality Score190
Status Validated
Chromosome3
Chromosomal Location88480147-88509956 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCTGCCCACAC to GC at 88482531 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029699] [ENSMUST00000036252] [ENSMUST00000120377]
Predicted Effect probably benign
Transcript: ENSMUST00000029699
SMART Domains Protein: ENSMUSP00000029699
Gene: ENSMUSG00000028063

DomainStartEndE-ValueType
Filament 30 386 4.38e-45 SMART
low complexity region 395 414 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
Pfam:LTD 433 544 4e-15 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 600 639 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036252
SMART Domains Protein: ENSMUSP00000040265
Gene: ENSMUSG00000028063

DomainStartEndE-ValueType
Pfam:Filament 2 274 5.6e-66 PFAM
low complexity region 283 302 N/A INTRINSIC
Pfam:LTD 317 436 1.2e-22 PFAM
low complexity region 439 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120377
SMART Domains Protein: ENSMUSP00000113093
Gene: ENSMUSG00000028063

DomainStartEndE-ValueType
Pfam:Filament 30 386 1.3e-95 PFAM
low complexity region 395 414 N/A INTRINSIC
Pfam:LTD 429 548 1.7e-22 PFAM
low complexity region 551 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150496
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the lamin family. Nuclear lamins, intermediate filament-like proteins, are the major components of the nuclear lamina, a protein meshwork associated with the inner nuclear membrane. This meshwork is thought to maintain the integrity of the nuclear envelope, participate in chromatin organization, and regulate gene transcription. Vertebrate lamins consist of two types, A and B. This protein is an A-type and is proposed to be developmentally regulated. In mouse deficiency of this gene is associated with muscular dystrophy. Mouse lines with different mutations in this gene serve as pathophysiological models for several human laminopathies. In humans, mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit retarded postnatal growth, muscular dystrophy, reduced fat stores, micrognathy, abnormal dentition, impaired gonadal development, malformed scapulae, hyperkeratosis, and die by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Lmna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lmna APN 3 88484684 missense probably benign 0.05
IGL00933:Lmna APN 3 88482549 missense possibly damaging 0.73
IGL01347:Lmna APN 3 88484963 missense probably benign 0.42
IGL02881:Lmna APN 3 88502926 missense possibly damaging 0.56
P0029:Lmna UTSW 3 88483917 missense possibly damaging 0.88
R0606:Lmna UTSW 3 88482578 missense probably damaging 1.00
R1547:Lmna UTSW 3 88482351 missense probably benign 0.00
R4751:Lmna UTSW 3 88486533 missense possibly damaging 0.87
R5157:Lmna UTSW 3 88484107 missense probably damaging 1.00
R6112:Lmna UTSW 3 88486621 nonsense probably null
R6263:Lmna UTSW 3 88502958 missense probably damaging 1.00
R6328:Lmna UTSW 3 88486506 missense probably damaging 1.00
R6604:Lmna UTSW 3 88488282 missense probably damaging 0.97
R7100:Lmna UTSW 3 88484990 missense probably damaging 0.99
R8080:Lmna UTSW 3 88486561 missense probably damaging 0.99
RF013:Lmna UTSW 3 88484054 missense probably benign 0.00
Z1177:Lmna UTSW 3 88486236 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGGGCAGAGATGACTCACCTG -3'
(R):5'- TACAGACAGAGGTCACCTTCCTG -3'

Sequencing Primer
(F):5'- AGAGATGACTCACCTGGCTCC -3'
(R):5'- CCAATGGCCAGGAAGCTC -3'
Posted On2017-02-10