Incidental Mutation 'R5857:Anks6'
ID454946
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Nameankyrin repeat and sterile alpha motif domain containing 6
Synonymsb2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5857 (G1)
Quality Score151
Status Validated
Chromosome4
Chromosomal Location47015669-47057427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47039736 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 492 (A492T)
Ref Sequence ENSEMBL: ENSMUSP00000155271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
Predicted Effect unknown
Transcript: ENSMUST00000084616
AA Change: A492T
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: A492T

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107747
AA Change: A492T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: A492T

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154664
Predicted Effect possibly damaging
Transcript: ENSMUST00000229609
AA Change: A492T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47046054 missense probably damaging 0.98
IGL01886:Anks6 APN 4 47044850 missense probably damaging 1.00
IGL02903:Anks6 APN 4 47045004 missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47027109 missense probably damaging 1.00
R0632:Anks6 UTSW 4 47033167 missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47025767 splice site probably benign
R1398:Anks6 UTSW 4 47044926 missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47044874 missense probably damaging 1.00
R1519:Anks6 UTSW 4 47027152 missense probably damaging 0.99
R1713:Anks6 UTSW 4 47039726 missense probably benign 0.00
R1781:Anks6 UTSW 4 47043639 missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47049387 missense probably benign 0.00
R2364:Anks6 UTSW 4 47027248 missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47049212 missense probably damaging 0.97
R4432:Anks6 UTSW 4 47044905 nonsense probably null
R4700:Anks6 UTSW 4 47033127 missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47033266 missense probably benign
R4876:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4877:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4878:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4879:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4961:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4962:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4968:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4970:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4971:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5092:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5113:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5389:Anks6 UTSW 4 47038900 splice site probably benign
R5569:Anks6 UTSW 4 47045007 missense probably damaging 1.00
R5977:Anks6 UTSW 4 47035748 missense probably benign 0.11
R5978:Anks6 UTSW 4 47049252 missense probably damaging 1.00
R6933:Anks6 UTSW 4 47049164 missense probably benign 0.25
R7175:Anks6 UTSW 4 47046268 intron probably null
R7454:Anks6 UTSW 4 47038919 missense unknown
R7874:Anks6 UTSW 4 47049275 missense unknown
R8146:Anks6 UTSW 4 47043605 missense unknown
Predicted Primers PCR Primer
(F):5'- CAATCAGCATGGCATGTGC -3'
(R):5'- TGGATCTGTCCTATTGTCAGCTAC -3'

Sequencing Primer
(F):5'- TAGTGTCTCCCAGATCAGCCG -3'
(R):5'- TGTCCTATTGTCAGCTACAGTTG -3'
Posted On2017-02-10