Mutagenetix > Incidental Mutation

Incidental Mutation 'R5857:Disp3'

454947

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

MMRRC Submission

044069-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5857 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 148249183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1066 (V1066D)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047720
AA Change: V1066D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: V1066D

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Meta Mutation Damage Score

0.1169

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

95% (55/58)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,449,525	I266V	probably benign	Het
Anks6	C	T	4: 47,039,736	A492T	possibly damaging	Het
Ano1	A	T	7: 144,637,103	C415S	probably benign	Het
Anxa3	T	A	5: 96,828,792		probably null	Het
Apob	T	C	12: 8,015,397	V4089A	probably benign	Het
Arhgap23	C	T	11: 97,451,579	A229V	possibly damaging	Het
Atad5	T	C	11: 80,131,329	F1447L	probably benign	Het
Btbd8	T	A	5: 107,461,532	D212E	probably damaging	Het
Ccdc38	G	T	10: 93,562,833	A58S	possibly damaging	Het
Cep112	T	C	11: 108,531,471		probably benign	Het
Col4a2	G	A	8: 11,425,442	G622D	probably damaging	Het
Crhbp	T	A	13: 95,442,232	Q134L	probably benign	Het
Ctnnbl1	T	C	2: 157,789,098	S145P	probably damaging	Het
Cyp4f16	T	A	17: 32,537,024	L9Q	probably damaging	Het
Dchs2	T	G	3: 83,270,313	I891S	possibly damaging	Het
Dlgap1	A	G	17: 70,815,393		probably benign	Het
Dnah3	TTCCTC	TTC	7: 119,951,021		probably benign	Het
Efl1	T	A	7: 82,763,189	C929S	probably benign	Het
Fam129b	T	A	2: 32,909,908	N82K	probably benign	Het
Gatb	T	C	3: 85,575,932	F82S	probably damaging	Het
Gk5	C	A	9: 96,119,455	S2*	probably null	Het
Gpr135	G	A	12: 72,070,840	A51V	probably benign	Het
Hoxa9	T	A	6: 52,224,297	N255Y	probably damaging	Het
Igkv8-18	T	C	6: 70,355,920	V15A	probably benign	Het
Ism2	T	C	12: 87,280,061	D368G	probably damaging	Het
Krtap6-2	A	T	16: 89,419,642	S146T	unknown	Het
Lama1	T	A	17: 67,807,843	L2329H	probably damaging	Het
Llgl2	T	A	11: 115,850,281	I507N	probably damaging	Het
Lmna	GCTGCCCACAC	GC	3: 88,482,531		probably benign	Het
Lrfn3	A	T	7: 30,359,438	I454N	possibly damaging	Het
Mdn1	C	A	4: 32,670,646	T437K	probably benign	Het
Nat8f3	T	C	6: 85,761,753	Y9C	probably damaging	Het
Nlrp4d	C	A	7: 10,382,377	G156V	noncoding transcript	Het
Npnt	A	T	3: 132,908,349	C167S	probably damaging	Het
Nr3c2	A	G	8: 76,908,867	N199S	possibly damaging	Het
Olfr248	T	G	1: 174,391,108	I13R	possibly damaging	Het
Olfr870	C	T	9: 20,171,239	D111N	probably damaging	Het
Olfr884	T	G	9: 38,047,753	V177G	probably benign	Het
Pabpc1l	T	A	2: 164,044,255		probably null	Het
Pi4ka	A	G	16: 17,358,984	I366T	probably benign	Het
Prl7a1	A	T	13: 27,640,701	D50E	probably damaging	Het
Rad52	T	G	6: 119,911,007		probably null	Het
Rbm19	T	A	5: 120,132,942	L610Q	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Scube1	G	T	15: 83,607,260		probably benign	Het
Sptbn4	G	T	7: 27,418,713	R314S	possibly damaging	Het
Togaram1	T	A	12: 64,995,557	I1130K	possibly damaging	Het
Tsc2	T	C	17: 24,600,007	E1352G	probably damaging	Het
Ube2d2a	A	G	18: 35,805,543	T142A	probably benign	Het
Vps18	T	C	2: 119,297,533	Y946H	probably damaging	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R0576:Disp3	UTSW	4	148241590	missense	possibly damaging	0.89
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R3731:Disp3	UTSW	4	148252827	missense	probably benign	0.03
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4950:Disp3	UTSW	4	148258126	missense	possibly damaging	0.94
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5556:Disp3	UTSW	4	148258157	missense	probably benign	0.14
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8357:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
R9182:Disp3	UTSW	4	148270384	missense	probably damaging	1.00
R9219:Disp3	UTSW	4	148249860	missense	possibly damaging	0.74
R9680:Disp3	UTSW	4	148271644	missense	probably damaging	1.00
R9696:Disp3	UTSW	4	148261154	missense	probably damaging	0.97
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCTGACACTGTCAACTG -3'
(R):5'- GACAACTGCCCGATGTTTGC -3'

Sequencing Primer
(F):5'- GTCAACTGCTAACTATGACCTCGGG -3'
(R):5'- GTTTGCAAACACACTGGAAGCTTG -3'

Posted On

2017-02-10