Incidental Mutation 'R5857:Hoxa9'
ID454951
Institutional Source Beutler Lab
Gene Symbol Hoxa9
Ensembl Gene ENSMUSG00000038227
Gene Namehomeobox A9
SynonymsD6a9, Hox-1.7
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52223100-52231089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52224297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 255 (N255Y)
Ref Sequence ENSEMBL: ENSMUSP00000046939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048680] [ENSMUST00000114425] [ENSMUST00000150041] [ENSMUST00000153280]
PDB Structure
Crystal Structure of HoxA9 and Pbx1 homeodomains bound to DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048680
AA Change: N255Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046939
Gene: ENSMUSG00000038227
AA Change: N255Y

DomainStartEndE-ValueType
Pfam:Hox9_act 1 192 3.8e-71 PFAM
HOX 205 267 3.3e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114425
SMART Domains Protein: ENSMUSP00000110068
Gene: ENSMUSG00000038227

DomainStartEndE-ValueType
Pfam:Hox9_act 1 105 5.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150041
SMART Domains Protein: ENSMUSP00000140519
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 43 56 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153280
SMART Domains Protein: ENSMUSP00000134641
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
HOX 8 70 1.72e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174115
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of similar genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important for hematopoeisis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations affecting lumbar vertebrae, reduced spleen and thymus weights, and defects in myeloid, erythroid, and lymphoid hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Hoxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0370:Hoxa9 UTSW 6 52225704 missense possibly damaging 0.48
R0727:Hoxa9 UTSW 6 52224314 missense probably damaging 0.99
R1173:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R1174:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R1175:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R4611:Hoxa9 UTSW 6 52225710 missense probably damaging 1.00
R7679:Hoxa9 UTSW 6 52224308 missense probably damaging 0.99
R7756:Hoxa9 UTSW 6 52225562 missense probably benign 0.17
R7758:Hoxa9 UTSW 6 52225562 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTTAGAGCCCCTTTGTGCG -3'
(R):5'- CCGGGATGCTCCTTCTAAAC -3'

Sequencing Primer
(F):5'- CCCCTTTGTGCGGGTGG -3'
(R):5'- GGGATGCTCCTTCTAAACCCAGTG -3'
Posted On2017-02-10