Incidental Mutation 'R5857:Rad52'
ID454954
Institutional Source Beutler Lab
Gene Symbol Rad52
Ensembl Gene ENSMUSG00000030166
Gene NameRAD52 homolog, DNA repair protein
Synonyms
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119902698-119922828 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 119911007 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032269] [ENSMUST00000032269] [ENSMUST00000161045] [ENSMUST00000162461]
Predicted Effect probably null
Transcript: ENSMUST00000032269
SMART Domains Protein: ENSMUSP00000032269
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 185 2.4e-56 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032269
SMART Domains Protein: ENSMUSP00000032269
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 185 2.4e-56 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160877
Predicted Effect probably benign
Transcript: ENSMUST00000161045
SMART Domains Protein: ENSMUSP00000125559
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
PDB:1H2I|V 1 64 2e-26 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162255
Predicted Effect probably null
Transcript: ENSMUST00000162461
SMART Domains Protein: ENSMUSP00000125502
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 184 6.6e-51 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162590
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit normal reproductive and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Rad52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Rad52 APN 6 119918633 missense probably damaging 1.00
IGL02376:Rad52 APN 6 119915230 splice site probably benign
IGL02572:Rad52 APN 6 119915227 splice site probably benign
IGL03292:Rad52 APN 6 119918973 missense possibly damaging 0.96
R1693:Rad52 UTSW 6 119916035 missense probably damaging 1.00
R2076:Rad52 UTSW 6 119911079 missense probably benign 0.39
R2110:Rad52 UTSW 6 119920894 missense possibly damaging 0.80
R4753:Rad52 UTSW 6 119912985 intron probably benign
R5866:Rad52 UTSW 6 119912946 intron probably benign
R6193:Rad52 UTSW 6 119920182 missense probably benign 0.03
R6369:Rad52 UTSW 6 119914207 missense unknown
Predicted Primers PCR Primer
(F):5'- AATAGCCACCTTTTCCAGCC -3'
(R):5'- GAAGTTCACAAATCCACGGG -3'

Sequencing Primer
(F):5'- TAGCCACCTTTTCCAGCCCATAATAG -3'
(R):5'- CATGACGACGGAAGCATTTC -3'
Posted On2017-02-10