Incidental Mutation 'R5857:Lrfn3'
ID454957
Institutional Source Beutler Lab
Gene Symbol Lrfn3
Ensembl Gene ENSMUSG00000036957
Gene Nameleucine rich repeat and fibronectin type III domain containing 3
SynonymsSALM4, A530045B06Rik
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5857 (G1)
Quality Score191
Status Validated
Chromosome7
Chromosomal Location30355489-30362772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30359438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 454 (I454N)
Ref Sequence ENSEMBL: ENSMUSP00000037616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046351
AA Change: I454N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037616
Gene: ENSMUSG00000036957
AA Change: I454N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 27 63 7.74e-2 SMART
LRR_TYP 82 105 5.81e-2 SMART
LRR_TYP 106 129 5.06e-2 SMART
LRR_TYP 130 153 6.42e-4 SMART
LRR 158 178 9.24e1 SMART
LRR 179 202 2.67e-1 SMART
LRR 203 226 1.12e1 SMART
LRRCT 249 294 2.72e-3 SMART
IGc2 308 373 2.23e-10 SMART
FN3 423 506 4e-1 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083048
Meta Mutation Damage Score 0.7211 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased frequency of excitatory and inhibitory postsynaptic freuqency and synapse density, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Lrfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Lrfn3 APN 7 30355964 missense probably damaging 0.98
R0565:Lrfn3 UTSW 7 30360791 missense probably benign 0.01
R0826:Lrfn3 UTSW 7 30360251 missense probably benign 0.01
R1029:Lrfn3 UTSW 7 30355922 missense probably damaging 0.99
R1434:Lrfn3 UTSW 7 30355927 missense possibly damaging 0.79
R1442:Lrfn3 UTSW 7 30360044 missense probably benign 0.01
R2078:Lrfn3 UTSW 7 30360454 missense possibly damaging 0.93
R4580:Lrfn3 UTSW 7 30360042 missense probably damaging 0.99
R4883:Lrfn3 UTSW 7 30355813 missense possibly damaging 0.87
R4928:Lrfn3 UTSW 7 30360623 missense possibly damaging 0.77
R5000:Lrfn3 UTSW 7 30360380 missense possibly damaging 0.48
R5364:Lrfn3 UTSW 7 30355653 missense possibly damaging 0.91
R5732:Lrfn3 UTSW 7 30359606 missense probably benign 0.22
R7999:Lrfn3 UTSW 7 30360024 missense probably damaging 1.00
R8146:Lrfn3 UTSW 7 30359879 missense probably benign 0.06
X0064:Lrfn3 UTSW 7 30360461 missense probably benign 0.17
Z1088:Lrfn3 UTSW 7 30360201 missense probably damaging 1.00
Z1177:Lrfn3 UTSW 7 30360659 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTGATTTCCTTTGGAACCTACAGTG -3'
(R):5'- ACTGCTGCTGTTGAGCTGAC -3'

Sequencing Primer
(F):5'- GGAACCTACAGTGTTATTTCCTTG -3'
(R):5'- CTGTTGAGCTGACCGTGG -3'
Posted On2017-02-10