Incidental Mutation 'R0555:Vmn2r81'
ID 45496
Institutional Source Beutler Lab
Gene Symbol Vmn2r81
Ensembl Gene ENSMUSG00000055515
Gene Name vomeronasal 2, receptor 81
Synonyms pheromone recepter, V2rf2, EC1-VR2
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0555 (G1)
Quality Score 214
Status Validated
Chromosome 10
Chromosomal Location 79083611-79130369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79129283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 725 (S725P)
Ref Sequence ENSEMBL: ENSMUSP00000020547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020547]
AlphaFold Q80Z09
Predicted Effect probably damaging
Transcript: ENSMUST00000020547
AA Change: S725P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020547
Gene: ENSMUSG00000055515
AA Change: S725P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 7.7e-37 PFAM
Pfam:NCD3G 517 570 8.9e-21 PFAM
Pfam:7tm_3 603 838 6.1e-50 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vomeronasal sensory neuron axons that spread out diffusely over the posterior accessory olfactory bulb and extend abnormally into the anterior olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Vmn2r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Vmn2r81 APN 10 79,083,831 (GRCm39) missense probably benign 0.20
IGL02255:Vmn2r81 APN 10 79,083,806 (GRCm39) nonsense probably null
IGL02901:Vmn2r81 APN 10 79,106,564 (GRCm39) missense probably damaging 0.98
R0383:Vmn2r81 UTSW 10 79,129,281 (GRCm39) missense possibly damaging 0.95
R0715:Vmn2r81 UTSW 10 79,104,434 (GRCm39) missense probably damaging 1.00
R0967:Vmn2r81 UTSW 10 79,083,857 (GRCm39) splice site probably benign
R1438:Vmn2r81 UTSW 10 79,129,691 (GRCm39) missense probably benign 0.00
R1468:Vmn2r81 UTSW 10 79,129,496 (GRCm39) missense probably damaging 1.00
R1468:Vmn2r81 UTSW 10 79,129,496 (GRCm39) missense probably damaging 1.00
R1589:Vmn2r81 UTSW 10 79,128,858 (GRCm39) missense probably damaging 0.99
R1671:Vmn2r81 UTSW 10 79,103,265 (GRCm39) missense probably benign 0.04
R1672:Vmn2r81 UTSW 10 79,104,112 (GRCm39) missense probably damaging 0.99
R1728:Vmn2r81 UTSW 10 79,106,489 (GRCm39) missense probably benign 0.08
R1784:Vmn2r81 UTSW 10 79,106,489 (GRCm39) missense probably benign 0.08
R1931:Vmn2r81 UTSW 10 79,129,328 (GRCm39) missense probably damaging 0.98
R1934:Vmn2r81 UTSW 10 79,083,628 (GRCm39) start codon destroyed probably null 0.71
R1944:Vmn2r81 UTSW 10 79,129,571 (GRCm39) missense probably damaging 1.00
R2102:Vmn2r81 UTSW 10 79,129,334 (GRCm39) missense probably damaging 0.97
R2190:Vmn2r81 UTSW 10 79,104,085 (GRCm39) missense possibly damaging 0.67
R2392:Vmn2r81 UTSW 10 79,110,516 (GRCm39) missense probably damaging 1.00
R3770:Vmn2r81 UTSW 10 79,106,434 (GRCm39) missense probably damaging 1.00
R4551:Vmn2r81 UTSW 10 79,104,241 (GRCm39) missense possibly damaging 0.95
R4629:Vmn2r81 UTSW 10 79,103,276 (GRCm39) missense probably damaging 0.99
R4691:Vmn2r81 UTSW 10 79,129,211 (GRCm39) nonsense probably null
R4829:Vmn2r81 UTSW 10 79,083,635 (GRCm39) missense possibly damaging 0.48
R4914:Vmn2r81 UTSW 10 79,106,357 (GRCm39) missense probably null 1.00
R4996:Vmn2r81 UTSW 10 79,129,247 (GRCm39) missense probably benign 0.04
R5242:Vmn2r81 UTSW 10 79,129,309 (GRCm39) nonsense probably null
R5253:Vmn2r81 UTSW 10 79,083,820 (GRCm39) missense probably benign 0.00
R5925:Vmn2r81 UTSW 10 79,083,637 (GRCm39) missense probably damaging 1.00
R6169:Vmn2r81 UTSW 10 79,104,382 (GRCm39) missense probably benign
R6270:Vmn2r81 UTSW 10 79,129,649 (GRCm39) missense probably benign
R6525:Vmn2r81 UTSW 10 79,129,560 (GRCm39) missense probably benign 0.11
R6813:Vmn2r81 UTSW 10 79,104,439 (GRCm39) missense probably benign 0.00
R6886:Vmn2r81 UTSW 10 79,103,988 (GRCm39) missense possibly damaging 0.90
R7200:Vmn2r81 UTSW 10 79,106,570 (GRCm39) critical splice donor site probably null
R7350:Vmn2r81 UTSW 10 79,104,219 (GRCm39) missense probably benign 0.03
R7504:Vmn2r81 UTSW 10 79,104,166 (GRCm39) missense probably benign
R7832:Vmn2r81 UTSW 10 79,129,664 (GRCm39) missense probably damaging 1.00
R8130:Vmn2r81 UTSW 10 79,110,538 (GRCm39) missense possibly damaging 0.95
R8362:Vmn2r81 UTSW 10 79,103,283 (GRCm39) missense probably benign 0.17
R8407:Vmn2r81 UTSW 10 79,104,028 (GRCm39) missense possibly damaging 0.92
R8540:Vmn2r81 UTSW 10 79,129,065 (GRCm39) missense probably damaging 0.99
R8558:Vmn2r81 UTSW 10 79,106,467 (GRCm39) missense possibly damaging 0.94
R8700:Vmn2r81 UTSW 10 79,129,517 (GRCm39) missense probably damaging 1.00
R8779:Vmn2r81 UTSW 10 79,103,218 (GRCm39) missense possibly damaging 0.78
R8987:Vmn2r81 UTSW 10 79,129,704 (GRCm39) missense probably damaging 1.00
R9001:Vmn2r81 UTSW 10 79,104,104 (GRCm39) missense possibly damaging 0.73
R9055:Vmn2r81 UTSW 10 79,110,441 (GRCm39) missense probably benign
R9145:Vmn2r81 UTSW 10 79,104,028 (GRCm39) missense possibly damaging 0.92
R9151:Vmn2r81 UTSW 10 79,103,905 (GRCm39) missense
R9253:Vmn2r81 UTSW 10 79,129,582 (GRCm39) missense probably damaging 1.00
R9255:Vmn2r81 UTSW 10 79,103,166 (GRCm39) missense possibly damaging 0.77
R9370:Vmn2r81 UTSW 10 79,104,424 (GRCm39) missense probably damaging 1.00
R9588:Vmn2r81 UTSW 10 79,129,205 (GRCm39) missense possibly damaging 0.46
X0067:Vmn2r81 UTSW 10 79,128,877 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGTAGACCACAGAGGCACTCCAATC -3'
(R):5'- GGGCAGTCTCCTGGATAAGAAAGC -3'

Sequencing Primer
(F):5'- GCAACAGTACATGTTTGGACTTCTG -3'
(R):5'- TCTCCTGGATAAGAAAGCCAAGAG -3'
Posted On 2013-06-11