Incidental Mutation 'R5857:Olfr884'
ID454965
Institutional Source Beutler Lab
Gene Symbol Olfr884
Ensembl Gene ENSMUSG00000095893
Gene Nameolfactory receptor 884
SynonymsMOR162-13, MOR162-9P, Olfr1550-ps1, MOR162-11P, MOR162-11P, GA_x6K02T2PVTD-31726544-31727473
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38046555-38050137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38047753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 177 (V177G)
Ref Sequence ENSEMBL: ENSMUSP00000138035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077732] [ENSMUST00000181088]
Predicted Effect probably benign
Transcript: ENSMUST00000077732
AA Change: V177G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076912
Gene: ENSMUSG00000095893
AA Change: V177G

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 5.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181088
AA Change: V177G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138035
Gene: ENSMUSG00000095893
AA Change: V177G

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 4.6e-30 PFAM
Pfam:7tm_4 138 281 3.9e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Olfr884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Olfr884 APN 9 38047740 missense probably damaging 1.00
IGL02612:Olfr884 APN 9 38047366 missense probably damaging 1.00
IGL02802:Olfr884 UTSW 9 38048049 missense probably damaging 0.99
R0015:Olfr884 UTSW 9 38047667 nonsense probably null
R0142:Olfr884 UTSW 9 38048110 missense probably benign 0.37
R0559:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0561:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0715:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0723:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0729:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R1350:Olfr884 UTSW 9 38047815 missense probably benign 0.02
R1869:Olfr884 UTSW 9 38048202 unclassified probably null
R3917:Olfr884 UTSW 9 38047545 missense probably damaging 1.00
R4131:Olfr884 UTSW 9 38047874 nonsense probably null
R4764:Olfr884 UTSW 9 38048140 missense probably benign
R5976:Olfr884 UTSW 9 38047701 missense possibly damaging 0.80
R6329:Olfr884 UTSW 9 38047825 missense probably benign 0.02
R7344:Olfr884 UTSW 9 38047957 missense probably benign
R8289:Olfr884 UTSW 9 38047704 missense probably benign 0.02
RF009:Olfr884 UTSW 9 38047747 missense probably damaging 1.00
X0052:Olfr884 UTSW 9 38047699 missense possibly damaging 0.53
Z1177:Olfr884 UTSW 9 38047815 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATATGCTGCCATTTGTAAGCC -3'
(R):5'- TGAAGGCTGCAGCTCCAAAG -3'

Sequencing Primer
(F):5'- GCCATTTGTAAGCCCCTGC -3'
(R):5'- AGGTACTGAAGGCTTTTGATCTACC -3'
Posted On2017-02-10