Incidental Mutation 'R5857:Ccdc38'
ID454966
Institutional Source Beutler Lab
Gene Symbol Ccdc38
Ensembl Gene ENSMUSG00000036168
Gene Namecoiled-coil domain containing 38
Synonyms
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93540632-93584327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93562833 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 58 (A58S)
Ref Sequence ENSEMBL: ENSMUSP00000150407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092215] [ENSMUST00000132214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092215
AA Change: A158S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168
AA Change: A158S

DomainStartEndE-ValueType
Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128786
Predicted Effect possibly damaging
Transcript: ENSMUST00000132214
AA Change: A58S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1860 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Ccdc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Ccdc38 APN 10 93569935 critical splice donor site probably null
IGL01986:Ccdc38 APN 10 93579843 missense probably damaging 1.00
IGL02396:Ccdc38 APN 10 93574132 missense possibly damaging 0.61
IGL02568:Ccdc38 APN 10 93579823 missense probably damaging 1.00
ANU23:Ccdc38 UTSW 10 93569935 critical splice donor site probably null
R0004:Ccdc38 UTSW 10 93574102 missense probably damaging 1.00
R0194:Ccdc38 UTSW 10 93565912 nonsense probably null
R0371:Ccdc38 UTSW 10 93562812 nonsense probably null
R1374:Ccdc38 UTSW 10 93582434 splice site probably benign
R1388:Ccdc38 UTSW 10 93581840 splice site probably benign
R1546:Ccdc38 UTSW 10 93565879 missense probably benign 0.01
R2377:Ccdc38 UTSW 10 93574035 missense probably damaging 1.00
R2419:Ccdc38 UTSW 10 93548975 missense probably benign 0.23
R3949:Ccdc38 UTSW 10 93550219 missense probably damaging 1.00
R5592:Ccdc38 UTSW 10 93550202 missense possibly damaging 0.58
R5652:Ccdc38 UTSW 10 93555586 splice site probably null
R5918:Ccdc38 UTSW 10 93570886 nonsense probably null
R5919:Ccdc38 UTSW 10 93578838 missense possibly damaging 0.95
R6057:Ccdc38 UTSW 10 93581746 missense probably damaging 1.00
R6293:Ccdc38 UTSW 10 93562797 nonsense probably null
R7511:Ccdc38 UTSW 10 93562800 missense possibly damaging 0.92
R8006:Ccdc38 UTSW 10 93555586 splice site probably null
R8206:Ccdc38 UTSW 10 93563284 missense probably damaging 0.97
R8313:Ccdc38 UTSW 10 93563249 missense probably damaging 1.00
Z1177:Ccdc38 UTSW 10 93562876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCTTGAAACCTCCAGG -3'
(R):5'- CACCGATCAGTGAGTTAGTTTGG -3'

Sequencing Primer
(F):5'- TCCAGGTACCTTGCCATGGAATG -3'
(R):5'- GAGGTAAGAGCGATACTAAC -3'
Posted On2017-02-10