Incidental Mutation 'R5857:Atad5'
ID454967
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene NameATPase family, AAA domain containing 5
SynonymsLOC237877, C130052G03Rik
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80089400-80135794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80131329 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1447 (F1447L)
Ref Sequence ENSEMBL: ENSMUSP00000103874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
Predicted Effect probably benign
Transcript: ENSMUST00000017694
AA Change: F1450L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: F1450L

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108239
AA Change: F1447L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: F1447L

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80132858 missense probably benign 0.22
IGL00916:Atad5 APN 11 80119000 missense probably damaging 1.00
IGL01348:Atad5 APN 11 80095564 missense probably benign 0.00
IGL01601:Atad5 APN 11 80095517 missense probably benign 0.45
IGL01916:Atad5 APN 11 80112839 critical splice donor site probably null
IGL02028:Atad5 APN 11 80134110 missense probably benign 0.20
IGL02095:Atad5 APN 11 80094707 missense probably benign 0.24
IGL02142:Atad5 APN 11 80094197 missense probably benign 0.00
IGL02206:Atad5 APN 11 80094183 missense probably damaging 1.00
IGL02385:Atad5 APN 11 80094627 missense probably benign 0.04
IGL02858:Atad5 APN 11 80089775 missense probably damaging 1.00
IGL02962:Atad5 APN 11 80108579 missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80111567 missense probably benign 0.04
R0040:Atad5 UTSW 11 80098014 missense probably benign
R0157:Atad5 UTSW 11 80089817 missense possibly damaging 0.74
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0319:Atad5 UTSW 11 80120790 splice site probably benign
R0401:Atad5 UTSW 11 80120699 missense probably benign 0.11
R0426:Atad5 UTSW 11 80112832 missense probably benign 0.14
R0452:Atad5 UTSW 11 80106421 missense probably damaging 0.98
R0496:Atad5 UTSW 11 80100356 missense probably benign 0.08
R1691:Atad5 UTSW 11 80095532 missense probably benign 0.00
R1812:Atad5 UTSW 11 80133047 missense probably damaging 0.98
R2070:Atad5 UTSW 11 80098052 splice site probably null
R2071:Atad5 UTSW 11 80098052 splice site probably null
R2153:Atad5 UTSW 11 80106377 missense probably benign 0.04
R2415:Atad5 UTSW 11 80094251 missense probably damaging 1.00
R3917:Atad5 UTSW 11 80103294 missense probably null 0.97
R4025:Atad5 UTSW 11 80120686 missense probably damaging 1.00
R4464:Atad5 UTSW 11 80100311 splice site probably null
R4561:Atad5 UTSW 11 80095889 missense probably benign 0.01
R4579:Atad5 UTSW 11 80095191 missense probably damaging 1.00
R4844:Atad5 UTSW 11 80114311 splice site probably null
R4853:Atad5 UTSW 11 80095272 missense probably damaging 1.00
R4873:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R4875:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R5054:Atad5 UTSW 11 80094676 missense probably benign 0.10
R5226:Atad5 UTSW 11 80095062 missense probably damaging 0.99
R5397:Atad5 UTSW 11 80111493 missense probably damaging 1.00
R5449:Atad5 UTSW 11 80124108 missense probably damaging 1.00
R5571:Atad5 UTSW 11 80111556 missense probably benign 0.05
R5575:Atad5 UTSW 11 80100323 missense probably benign 0.02
R5927:Atad5 UTSW 11 80127285 missense probably damaging 1.00
R5928:Atad5 UTSW 11 80094177 missense probably damaging 1.00
R5949:Atad5 UTSW 11 80096009 nonsense probably null
R6102:Atad5 UTSW 11 80111572 critical splice donor site probably null
R6254:Atad5 UTSW 11 80127389 missense probably damaging 0.96
R6562:Atad5 UTSW 11 80133206 missense probably benign 0.26
R6744:Atad5 UTSW 11 80134032 missense probably benign 0.00
R7092:Atad5 UTSW 11 80120720 missense possibly damaging 0.68
R7202:Atad5 UTSW 11 80089775 missense probably damaging 1.00
R7345:Atad5 UTSW 11 80096006 missense probably damaging 1.00
R7352:Atad5 UTSW 11 80103343 critical splice donor site probably null
R7358:Atad5 UTSW 11 80133036 missense probably benign 0.32
R7420:Atad5 UTSW 11 80095862 missense probably benign 0.06
R7453:Atad5 UTSW 11 80119143 critical splice donor site probably null
R8012:Atad5 UTSW 11 80094240 missense probably damaging 1.00
R8152:Atad5 UTSW 11 80095170 missense possibly damaging 0.59
RF003:Atad5 UTSW 11 80111560 missense probably damaging 0.99
X0024:Atad5 UTSW 11 80132783 missense probably benign 0.02
Z1176:Atad5 UTSW 11 80094896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCACATTGTGGAGAAC -3'
(R):5'- AGGCGTCAACACAGTCAATTG -3'

Sequencing Primer
(F):5'- CTTCTATTTGGGTCATTTCAAAAGC -3'
(R):5'- TGTAACGAGATCTGATGCCC -3'
Posted On2017-02-10