Incidental Mutation 'R5857:Cep112'
ID454970
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Namecentrosomal protein 112
SynonymsMacoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R5857 (G1)
Quality Score203
Status Validated
Chromosome11
Chromosomal Location108425192-108860615 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 108531471 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000133670] [ENSMUST00000138538] [ENSMUST00000150863] [ENSMUST00000182729]
Predicted Effect probably benign
Transcript: ENSMUST00000061287
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130515
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133670
SMART Domains Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
internal_repeat_2 66 104 4.9e-5 PROSPERO
internal_repeat_1 81 110 2.63e-5 PROSPERO
coiled coil region 123 203 N/A INTRINSIC
internal_repeat_3 252 264 4.9e-5 PROSPERO
low complexity region 317 328 N/A INTRINSIC
internal_repeat_2 332 370 4.9e-5 PROSPERO
internal_repeat_3 532 544 4.9e-5 PROSPERO
internal_repeat_1 540 569 2.63e-5 PROSPERO
coiled coil region 571 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137907
Predicted Effect probably benign
Transcript: ENSMUST00000138538
SMART Domains Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.7e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150863
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182249
Predicted Effect probably benign
Transcript: ENSMUST00000182729
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R2882:Cep112 UTSW 11 108519212 missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4407:Cep112 UTSW 11 108519201 missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R4977:Cep112 UTSW 11 108434236 missense probably damaging 0.97
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5560:Cep112 UTSW 11 108437235 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108855870 missense probably damaging 1.00
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
R7386:Cep112 UTSW 11 108808681 missense probably benign 0.00
R7539:Cep112 UTSW 11 108855828 missense probably benign 0.38
R8262:Cep112 UTSW 11 108503151 missense probably damaging 1.00
Z1176:Cep112 UTSW 11 108425310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGTCTTCTCAAGCATGTGG -3'
(R):5'- TGAACTATGAGCAACCTGTGTG -3'

Sequencing Primer
(F):5'- GTCTTCTCAAGCATGTGGAATTTC -3'
(R):5'- AGTGTCCACTGAGTCCAGAG -3'
Posted On2017-02-10