Incidental Mutation 'R5857:Togaram1'
ID454973
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64995557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1130 (I1130K)
Ref Sequence ENSEMBL: ENSMUSP00000070382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066296] [ENSMUST00000223166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066296
AA Change: I1130K

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: I1130K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221400
Predicted Effect probably benign
Transcript: ENSMUST00000223166
AA Change: I1180K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.2906 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1111:Togaram1 UTSW 12 65006341 missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 64995635 missense probably damaging 0.98
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2407:Togaram1 UTSW 12 64967670 missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
R7451:Togaram1 UTSW 12 64996975 missense probably damaging 1.00
R7504:Togaram1 UTSW 12 64992617 missense possibly damaging 0.79
R7560:Togaram1 UTSW 12 65011142 missense possibly damaging 0.52
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAAACCACTATCTTCTTGTCTG -3'
(R):5'- GCAGGAACACATAGACAAGTTC -3'

Sequencing Primer
(F):5'- AACCACTATCTTCTTGTCTGATTAGG -3'
(R):5'- TTAATCCCAGCACTTGGTAGGCAG -3'
Posted On2017-02-10