Incidental Mutation 'R5857:Crhbp'
ID454976
Institutional Source Beutler Lab
Gene Symbol Crhbp
Ensembl Gene ENSMUSG00000021680
Gene Namecorticotropin releasing hormone binding protein
SynonymsCRH-BP
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95431371-95444924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95442232 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 134 (Q134L)
Ref Sequence ENSEMBL: ENSMUSP00000042578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045583] [ENSMUST00000221025]
Predicted Effect probably benign
Transcript: ENSMUST00000045583
AA Change: Q134L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042578
Gene: ENSMUSG00000021680
AA Change: Q134L

DomainStartEndE-ValueType
Pfam:CRF-BP 1 307 1.1e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221025
AA Change: Q127L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display behavior indicative of increased anxiety. Male mice also show reduced food intake resulting in reduced growth between ages 7 and 15 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Crhbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Crhbp APN 13 95443787 missense probably damaging 0.96
IGL03058:Crhbp APN 13 95443798 missense probably damaging 1.00
R0518:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R0521:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R1120:Crhbp UTSW 13 95442085 missense probably benign 0.01
R4417:Crhbp UTSW 13 95443877 missense probably benign 0.02
R4925:Crhbp UTSW 13 95443810 missense possibly damaging 0.93
R4999:Crhbp UTSW 13 95442245 missense probably damaging 1.00
R5332:Crhbp UTSW 13 95436455 missense probably damaging 0.99
R5568:Crhbp UTSW 13 95442229 missense probably damaging 1.00
R5861:Crhbp UTSW 13 95443825 missense probably damaging 1.00
R5875:Crhbp UTSW 13 95443796 missense probably benign 0.00
R5911:Crhbp UTSW 13 95432056 missense probably benign 0.00
R6235:Crhbp UTSW 13 95443850 missense probably damaging 1.00
R7038:Crhbp UTSW 13 95444191 missense probably damaging 1.00
R7885:Crhbp UTSW 13 95432007 missense probably damaging 0.96
R7968:Crhbp UTSW 13 95432007 missense probably damaging 0.96
X0052:Crhbp UTSW 13 95431993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACGGAAGAGGTTGGGATC -3'
(R):5'- AAGCAAGCAGGCTGTGAGTC -3'

Sequencing Primer
(F):5'- CTGTCTTTATGGTTATCGTGAATCC -3'
(R):5'- CGAAGGTTGTTAACGTCCCC -3'
Posted On2017-02-10