Incidental Mutation 'R5858:Col8a2'
ID 454999
Institutional Source Beutler Lab
Gene Symbol Col8a2
Ensembl Gene ENSMUSG00000056174
Gene Name collagen, type VIII, alpha 2
Synonyms
MMRRC Submission 044070-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R5858 (G1)
Quality Score 126
Status Validated
Chromosome 4
Chromosomal Location 126286793-126314330 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 126311300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617] [ENSMUST00000128435]
AlphaFold P25318
Predicted Effect unknown
Transcript: ENSMUST00000070132
AA Change: R368C
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: R368C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000128435
SMART Domains Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Meta Mutation Damage Score 0.3883 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,853,605 Q102L probably benign Het
Ak9 G A 10: 41,423,027 V1575I unknown Het
Alg14 G A 3: 121,320,088 probably benign Het
Arl5a T C 2: 52,412,106 I99V probably benign Het
Cacul1 T C 19: 60,529,044 probably benign Het
Cc2d2a C T 5: 43,715,775 R934C probably damaging Het
Ccr2 A G 9: 124,106,427 E248G probably benign Het
Cds2 G T 2: 132,302,113 V287L probably benign Het
Cflar T C 1: 58,753,851 S459P probably benign Het
Clcc1 A G 3: 108,661,428 D21G probably damaging Het
Cops7a A T 6: 124,960,171 S186T possibly damaging Het
Dagla C T 19: 10,254,968 probably benign Het
Dapp1 T C 3: 137,961,531 Y49C possibly damaging Het
Dnase1 T C 16: 4,039,649 probably benign Het
Dock9 A G 14: 121,628,792 V633A probably benign Het
E4f1 A G 17: 24,445,328 F461L probably damaging Het
Epg5 T A 18: 77,948,299 C70* probably null Het
Ephb2 T C 4: 136,672,445 H589R probably benign Het
Fam184b A T 5: 45,639,119 C41S probably damaging Het
Hace1 A G 10: 45,711,525 T907A possibly damaging Het
Il31 T A 5: 123,480,574 T129S probably benign Het
Il6 A T 5: 30,013,474 T23S possibly damaging Het
Kif12 T C 4: 63,166,410 E557G probably benign Het
Krt24 A T 11: 99,284,765 L148H probably damaging Het
Mapk8ip1 A G 2: 92,384,972 F635S probably damaging Het
Mcc A T 18: 44,510,141 V313E probably damaging Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Nbea A G 3: 55,953,034 probably null Het
Olfr1145 A T 2: 87,810,641 I274F probably benign Het
Olfr1442 A G 19: 12,674,379 Y58C probably damaging Het
Olfr165 A G 16: 19,407,225 S265P possibly damaging Het
Olfr705 T A 7: 106,873,768 Y159F probably benign Het
P4ha1 A T 10: 59,339,378 L53F probably damaging Het
Pcdha7 A G 18: 36,976,226 D768G probably damaging Het
Pdzd2 T A 15: 12,442,589 D208V probably damaging Het
Ptk2 A T 15: 73,321,095 I159K probably benign Het
Rfx6 A G 10: 51,725,868 N761S probably benign Het
Rpp25l A T 4: 41,712,678 D32E probably benign Het
Rxrg A T 1: 167,627,356 K169N probably damaging Het
Ryr2 T C 13: 11,560,574 D4846G probably damaging Het
Sec23a A G 12: 58,973,035 F553S probably damaging Het
Spen T C 4: 141,473,871 I2482V probably benign Het
Ston1 A G 17: 88,635,631 D155G possibly damaging Het
Tha1 A G 11: 117,873,384 F6L unknown Het
Trank1 T A 9: 111,392,536 D2780E probably benign Het
Ubqln5 T C 7: 104,128,811 T269A probably benign Het
Vars C T 17: 35,005,475 R324C probably benign Het
Zfp287 T A 11: 62,714,007 Q691H probably damaging Het
Other mutations in Col8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col8a2 APN 4 126309791 missense probably damaging 0.99
IGL01776:Col8a2 APN 4 126309805 unclassified probably benign
IGL03367:Col8a2 APN 4 126312198 missense probably damaging 1.00
R1861:Col8a2 UTSW 4 126311624 unclassified probably benign
R1909:Col8a2 UTSW 4 126312133 missense possibly damaging 0.63
R2038:Col8a2 UTSW 4 126311315 unclassified probably benign
R2866:Col8a2 UTSW 4 126311199 unclassified probably benign
R4013:Col8a2 UTSW 4 126311115 unclassified probably benign
R4586:Col8a2 UTSW 4 126311019 unclassified probably benign
R4995:Col8a2 UTSW 4 126310788 missense probably damaging 0.98
R5160:Col8a2 UTSW 4 126310412 missense possibly damaging 0.77
R5574:Col8a2 UTSW 4 126311268 unclassified probably benign
R6803:Col8a2 UTSW 4 126312000 missense probably damaging 1.00
R8876:Col8a2 UTSW 4 126310854 missense probably damaging 0.96
Z1177:Col8a2 UTSW 4 126311543 missense unknown
Predicted Primers PCR Primer
(F):5'- CTATGGGATGCCAGGAAAACC -3'
(R):5'- AAGTCACCTTTCTGTCCTAGGGC -3'

Sequencing Primer
(F):5'- TGCCAGGAAAACCAGGACCTAAG -3'
(R):5'- TGTAAAACCTGGCTCACCCTTAGG -3'
Posted On 2017-02-10