Incidental Mutation 'R5858:Il6'
ID455001
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Nameinterleukin 6
SynonymsIl-6
MMRRC Submission 044070-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R5858 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30013114-30019981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30013474 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 23 (T23S)
Ref Sequence ENSEMBL: ENSMUSP00000143157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026845
AA Change: T40S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: T40S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195978
AA Change: T40S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746
AA Change: T40S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199183
AA Change: T40S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746
AA Change: T40S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199765
AA Change: T23S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: T23S

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200055
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,853,605 Q102L probably benign Het
Ak9 G A 10: 41,423,027 V1575I unknown Het
Alg14 G A 3: 121,320,088 probably benign Het
Arl5a T C 2: 52,412,106 I99V probably benign Het
Cacul1 T C 19: 60,529,044 probably benign Het
Cc2d2a C T 5: 43,715,775 R934C probably damaging Het
Ccr2 A G 9: 124,106,427 E248G probably benign Het
Cds2 G T 2: 132,302,113 V287L probably benign Het
Cflar T C 1: 58,753,851 S459P probably benign Het
Clcc1 A G 3: 108,661,428 D21G probably damaging Het
Col8a2 C T 4: 126,311,300 probably benign Het
Cops7a A T 6: 124,960,171 S186T possibly damaging Het
Dagla C T 19: 10,254,968 probably benign Het
Dapp1 T C 3: 137,961,531 Y49C possibly damaging Het
Dnase1 T C 16: 4,039,649 probably benign Het
Dock9 A G 14: 121,628,792 V633A probably benign Het
E4f1 A G 17: 24,445,328 F461L probably damaging Het
Epg5 T A 18: 77,948,299 C70* probably null Het
Ephb2 T C 4: 136,672,445 H589R probably benign Het
Fam184b A T 5: 45,639,119 C41S probably damaging Het
Hace1 A G 10: 45,711,525 T907A possibly damaging Het
Il31 T A 5: 123,480,574 T129S probably benign Het
Kif12 T C 4: 63,166,410 E557G probably benign Het
Krt24 A T 11: 99,284,765 L148H probably damaging Het
Mapk8ip1 A G 2: 92,384,972 F635S probably damaging Het
Mcc A T 18: 44,510,141 V313E probably damaging Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Nbea A G 3: 55,953,034 probably null Het
Olfr1145 A T 2: 87,810,641 I274F probably benign Het
Olfr1442 A G 19: 12,674,379 Y58C probably damaging Het
Olfr165 A G 16: 19,407,225 S265P possibly damaging Het
Olfr705 T A 7: 106,873,768 Y159F probably benign Het
P4ha1 A T 10: 59,339,378 L53F probably damaging Het
Pcdha7 A G 18: 36,976,226 D768G probably damaging Het
Pdzd2 T A 15: 12,442,589 D208V probably damaging Het
Ptk2 A T 15: 73,321,095 I159K probably benign Het
Rfx6 A G 10: 51,725,868 N761S probably benign Het
Rpp25l A T 4: 41,712,678 D32E probably benign Het
Rxrg A T 1: 167,627,356 K169N probably damaging Het
Ryr2 T C 13: 11,560,574 D4846G probably damaging Het
Sec23a A G 12: 58,973,035 F553S probably damaging Het
Spen T C 4: 141,473,871 I2482V probably benign Het
Ston1 A G 17: 88,635,631 D155G possibly damaging Het
Tha1 A G 11: 117,873,384 F6L unknown Het
Trank1 T A 9: 111,392,536 D2780E probably benign Het
Ubqln5 T C 7: 104,128,811 T269A probably benign Het
Vars C T 17: 35,005,475 R324C probably benign Het
Zfp287 T A 11: 62,714,007 Q691H probably damaging Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30014841 missense probably benign 0.06
IGL01085:Il6 APN 5 30013489 missense probably damaging 0.98
IGL01549:Il6 APN 5 30019471 missense probably benign 0.01
R1510:Il6 UTSW 5 30018062 missense probably damaging 0.96
R1721:Il6 UTSW 5 30013492 missense possibly damaging 0.90
R1774:Il6 UTSW 5 30019435 missense probably benign
R2018:Il6 UTSW 5 30014947 critical splice donor site probably null
R2153:Il6 UTSW 5 30013504 nonsense probably null
R2344:Il6 UTSW 5 30014856 missense probably benign 0.00
R3889:Il6 UTSW 5 30018068 missense possibly damaging 0.57
R4743:Il6 UTSW 5 30018044 missense probably damaging 0.96
R4769:Il6 UTSW 5 30018078 nonsense probably null
R4965:Il6 UTSW 5 30013493 missense possibly damaging 0.53
R5024:Il6 UTSW 5 30019514 missense probably damaging 1.00
R5817:Il6 UTSW 5 30018008 missense probably benign
R6886:Il6 UTSW 5 30018203 intron probably benign
R7254:Il6 UTSW 5 30014908 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAGCCAGCATTGTGGGTTG -3'
(R):5'- CTGACCTTTAGCTTCAAATCCTAAG -3'

Sequencing Primer
(F):5'- CATTGTGGGTTGGCCAGCAG -3'
(R):5'- TTAGCTTCAAATCCTAAGGGCCCTAG -3'
Posted On2017-02-10