Incidental Mutation 'R5858:Ak9'
ID455011
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Nameadenylate kinase 9
SynonymsLOC215946, Akd1, Gm7127, Akd2
MMRRC Submission 044070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5858 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41303980-41434534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41423027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1575 (V1575I)
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
Predicted Effect unknown
Transcript: ENSMUST00000173494
AA Change: V1575I
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: V1575I

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,853,605 Q102L probably benign Het
Alg14 G A 3: 121,320,088 probably benign Het
Arl5a T C 2: 52,412,106 I99V probably benign Het
Cacul1 T C 19: 60,529,044 probably benign Het
Cc2d2a C T 5: 43,715,775 R934C probably damaging Het
Ccr2 A G 9: 124,106,427 E248G probably benign Het
Cds2 G T 2: 132,302,113 V287L probably benign Het
Cflar T C 1: 58,753,851 S459P probably benign Het
Clcc1 A G 3: 108,661,428 D21G probably damaging Het
Col8a2 C T 4: 126,311,300 probably benign Het
Cops7a A T 6: 124,960,171 S186T possibly damaging Het
Dagla C T 19: 10,254,968 probably benign Het
Dapp1 T C 3: 137,961,531 Y49C possibly damaging Het
Dnase1 T C 16: 4,039,649 probably benign Het
Dock9 A G 14: 121,628,792 V633A probably benign Het
E4f1 A G 17: 24,445,328 F461L probably damaging Het
Epg5 T A 18: 77,948,299 C70* probably null Het
Ephb2 T C 4: 136,672,445 H589R probably benign Het
Fam184b A T 5: 45,639,119 C41S probably damaging Het
Hace1 A G 10: 45,711,525 T907A possibly damaging Het
Il31 T A 5: 123,480,574 T129S probably benign Het
Il6 A T 5: 30,013,474 T23S possibly damaging Het
Kif12 T C 4: 63,166,410 E557G probably benign Het
Krt24 A T 11: 99,284,765 L148H probably damaging Het
Mapk8ip1 A G 2: 92,384,972 F635S probably damaging Het
Mcc A T 18: 44,510,141 V313E probably damaging Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Nbea A G 3: 55,953,034 probably null Het
Olfr1145 A T 2: 87,810,641 I274F probably benign Het
Olfr1442 A G 19: 12,674,379 Y58C probably damaging Het
Olfr165 A G 16: 19,407,225 S265P possibly damaging Het
Olfr705 T A 7: 106,873,768 Y159F probably benign Het
P4ha1 A T 10: 59,339,378 L53F probably damaging Het
Pcdha7 A G 18: 36,976,226 D768G probably damaging Het
Pdzd2 T A 15: 12,442,589 D208V probably damaging Het
Ptk2 A T 15: 73,321,095 I159K probably benign Het
Rfx6 A G 10: 51,725,868 N761S probably benign Het
Rpp25l A T 4: 41,712,678 D32E probably benign Het
Rxrg A T 1: 167,627,356 K169N probably damaging Het
Ryr2 T C 13: 11,560,574 D4846G probably damaging Het
Sec23a A G 12: 58,973,035 F553S probably damaging Het
Spen T C 4: 141,473,871 I2482V probably benign Het
Ston1 A G 17: 88,635,631 D155G possibly damaging Het
Tha1 A G 11: 117,873,384 F6L unknown Het
Trank1 T A 9: 111,392,536 D2780E probably benign Het
Ubqln5 T C 7: 104,128,811 T269A probably benign Het
Vars C T 17: 35,005,475 R324C probably benign Het
Zfp287 T A 11: 62,714,007 Q691H probably damaging Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mean UTSW 10 41357563 missense possibly damaging 0.59
R0057:Ak9 UTSW 10 41392728 missense probably benign 0.04
R0605:Ak9 UTSW 10 41345139 missense probably damaging 1.00
R0658:Ak9 UTSW 10 41347222 missense probably damaging 0.98
R1696:Ak9 UTSW 10 41327589 missense possibly damaging 0.73
R1738:Ak9 UTSW 10 41335921 missense possibly damaging 0.86
R1815:Ak9 UTSW 10 41337576 missense probably damaging 1.00
R2900:Ak9 UTSW 10 41424755 missense unknown
R3123:Ak9 UTSW 10 41358580 missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41357512 missense probably damaging 0.96
R4092:Ak9 UTSW 10 41389144 missense probably benign 0.29
R4193:Ak9 UTSW 10 41335945 missense probably benign 0.14
R4598:Ak9 UTSW 10 41383911 missense probably damaging 1.00
R4621:Ak9 UTSW 10 41406891 missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41427238 missense unknown
R4707:Ak9 UTSW 10 41345460 missense probably benign 0.36
R4908:Ak9 UTSW 10 41420682 missense unknown
R4952:Ak9 UTSW 10 41420589 missense probably benign 0.07
R5162:Ak9 UTSW 10 41357657 missense probably damaging 1.00
R5446:Ak9 UTSW 10 41420509 missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41347169 missense probably damaging 1.00
R5517:Ak9 UTSW 10 41340891 missense probably benign 0.23
R5849:Ak9 UTSW 10 41348049 missense probably benign 0.31
R5920:Ak9 UTSW 10 41420676 missense probably benign 0.30
R5952:Ak9 UTSW 10 41357563 missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41358564 missense probably damaging 1.00
R6050:Ak9 UTSW 10 41389112 missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41382832 missense probably benign 0.01
R6190:Ak9 UTSW 10 41422407 missense unknown
R6190:Ak9 UTSW 10 41422408 missense unknown
R6197:Ak9 UTSW 10 41317830 missense probably damaging 0.98
R6220:Ak9 UTSW 10 41370099 missense unknown
R6250:Ak9 UTSW 10 41389034 missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41406841 missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41382829 missense probably damaging 0.99
R6812:Ak9 UTSW 10 41367167 missense unknown
R6847:Ak9 UTSW 10 41357801 intron probably null
R7128:Ak9 UTSW 10 41424717 missense unknown
R7253:Ak9 UTSW 10 41432484 missense unknown
R7286:Ak9 UTSW 10 41407371 missense
R7401:Ak9 UTSW 10 41423004 missense unknown
R7478:Ak9 UTSW 10 41389091 missense
Predicted Primers PCR Primer
(F):5'- GAAACAGGGTGAAGCTGTCT -3'
(R):5'- CAGAGGTTGCTCTGTGAGGA -3'

Sequencing Primer
(F):5'- GAGAATGTTTTACACCTTCAACAGC -3'
(R):5'- AGGATGTCCTCTGGTCTTTATACTC -3'
Posted On2017-02-10