Incidental Mutation 'R0555:Myh2'
ID 45502
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Name myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms Myhs-f, Myhsf1, MHC2A, Myhs-f1, MyHC-IIa
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R0555 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 67061853-67088343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67069793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 380 (G380C)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
AlphaFold G3UW82
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: G380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: G380C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124337
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: G380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: G380C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.7678 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67,076,059 (GRCm39) missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67,084,266 (GRCm39) missense probably benign 0.06
IGL00423:Myh2 APN 11 67,088,171 (GRCm39) missense probably benign
IGL00429:Myh2 APN 11 67,071,616 (GRCm39) nonsense probably null
IGL00465:Myh2 APN 11 67,069,659 (GRCm39) splice site probably benign
IGL00671:Myh2 APN 11 67,084,183 (GRCm39) missense probably damaging 0.97
IGL00773:Myh2 APN 11 67,085,247 (GRCm39) missense probably benign
IGL00821:Myh2 APN 11 67,088,223 (GRCm39) utr 3 prime probably benign
IGL00900:Myh2 APN 11 67,070,210 (GRCm39) missense probably damaging 1.00
IGL01374:Myh2 APN 11 67,068,250 (GRCm39) missense probably benign 0.05
IGL01613:Myh2 APN 11 67,088,170 (GRCm39) missense probably benign 0.01
IGL01845:Myh2 APN 11 67,083,860 (GRCm39) missense probably benign 0.02
IGL01900:Myh2 APN 11 67,074,609 (GRCm39) missense probably benign 0.01
IGL01936:Myh2 APN 11 67,082,599 (GRCm39) missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67,076,084 (GRCm39) missense probably benign 0.05
IGL02172:Myh2 APN 11 67,079,878 (GRCm39) missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67,079,991 (GRCm39) missense probably benign 0.00
IGL02578:Myh2 APN 11 67,077,517 (GRCm39) missense probably benign 0.33
IGL03075:Myh2 APN 11 67,071,662 (GRCm39) missense probably benign 0.39
IGL03078:Myh2 APN 11 67,081,256 (GRCm39) missense probably benign
IGL03117:Myh2 APN 11 67,071,710 (GRCm39) missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67,084,051 (GRCm39) missense probably damaging 1.00
IGL03266:Myh2 APN 11 67,067,150 (GRCm39) missense probably benign
IGL03366:Myh2 APN 11 67,074,349 (GRCm39) missense probably damaging 1.00
IGL03412:Myh2 APN 11 67,080,395 (GRCm39) missense probably benign 0.04
limp UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
noodle UTSW 11 67,077,438 (GRCm39) missense probably benign
PIT4403001:Myh2 UTSW 11 67,077,533 (GRCm39) missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67,076,331 (GRCm39) missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67,072,818 (GRCm39) missense probably benign
R0039:Myh2 UTSW 11 67,069,103 (GRCm39) missense probably damaging 1.00
R0347:Myh2 UTSW 11 67,076,130 (GRCm39) splice site probably benign
R0389:Myh2 UTSW 11 67,071,647 (GRCm39) missense probably damaging 1.00
R0400:Myh2 UTSW 11 67,083,424 (GRCm39) splice site probably benign
R0512:Myh2 UTSW 11 67,079,504 (GRCm39) missense probably damaging 1.00
R0746:Myh2 UTSW 11 67,064,257 (GRCm39) missense probably benign 0.00
R0842:Myh2 UTSW 11 67,070,350 (GRCm39) missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67,077,334 (GRCm39) missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67,083,351 (GRCm39) missense probably damaging 0.99
R1264:Myh2 UTSW 11 67,071,604 (GRCm39) missense probably damaging 0.96
R1398:Myh2 UTSW 11 67,076,113 (GRCm39) missense probably benign 0.14
R1774:Myh2 UTSW 11 67,064,300 (GRCm39) missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67,079,764 (GRCm39) missense probably damaging 0.99
R1829:Myh2 UTSW 11 67,067,385 (GRCm39) missense probably damaging 0.98
R1840:Myh2 UTSW 11 67,077,313 (GRCm39) missense probably benign 0.16
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1969:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67,071,740 (GRCm39) missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67,082,545 (GRCm39) missense probably damaging 1.00
R2029:Myh2 UTSW 11 67,085,451 (GRCm39) missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67,079,665 (GRCm39) critical splice donor site probably null
R2080:Myh2 UTSW 11 67,065,767 (GRCm39) critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67,080,158 (GRCm39) missense probably damaging 1.00
R2215:Myh2 UTSW 11 67,082,563 (GRCm39) missense probably benign 0.35
R2225:Myh2 UTSW 11 67,084,555 (GRCm39) missense probably benign
R2274:Myh2 UTSW 11 67,081,184 (GRCm39) missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67,070,410 (GRCm39) missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67,076,012 (GRCm39) missense probably damaging 1.00
R3703:Myh2 UTSW 11 67,080,427 (GRCm39) missense probably benign 0.01
R4022:Myh2 UTSW 11 67,070,230 (GRCm39) nonsense probably null
R4081:Myh2 UTSW 11 67,081,256 (GRCm39) missense probably benign 0.11
R4191:Myh2 UTSW 11 67,068,226 (GRCm39) missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67,071,985 (GRCm39) missense probably benign 0.01
R4292:Myh2 UTSW 11 67,085,723 (GRCm39) missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67,083,551 (GRCm39) missense probably benign 0.01
R4524:Myh2 UTSW 11 67,067,096 (GRCm39) missense probably damaging 1.00
R4578:Myh2 UTSW 11 67,064,084 (GRCm39) missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67,080,244 (GRCm39) missense probably benign 0.01
R4641:Myh2 UTSW 11 67,085,520 (GRCm39) missense probably damaging 1.00
R4672:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4673:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4804:Myh2 UTSW 11 67,077,328 (GRCm39) missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67,067,081 (GRCm39) missense probably damaging 1.00
R4943:Myh2 UTSW 11 67,088,143 (GRCm39) missense probably damaging 1.00
R4958:Myh2 UTSW 11 67,083,785 (GRCm39) missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67,070,174 (GRCm39) missense probably damaging 1.00
R5239:Myh2 UTSW 11 67,083,269 (GRCm39) missense probably benign 0.00
R5306:Myh2 UTSW 11 67,077,382 (GRCm39) missense probably damaging 1.00
R5492:Myh2 UTSW 11 67,071,701 (GRCm39) missense probably benign 0.20
R5503:Myh2 UTSW 11 67,064,275 (GRCm39) missense probably benign
R5646:Myh2 UTSW 11 67,079,638 (GRCm39) missense probably benign 0.07
R5750:Myh2 UTSW 11 67,082,254 (GRCm39) missense probably benign
R5806:Myh2 UTSW 11 67,072,141 (GRCm39) missense probably damaging 0.98
R5878:Myh2 UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
R5892:Myh2 UTSW 11 67,076,002 (GRCm39) nonsense probably null
R5898:Myh2 UTSW 11 67,083,545 (GRCm39) missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6156:Myh2 UTSW 11 67,071,879 (GRCm39) missense probably damaging 0.98
R6236:Myh2 UTSW 11 67,081,157 (GRCm39) missense probably benign 0.00
R6349:Myh2 UTSW 11 67,083,829 (GRCm39) missense probably benign 0.04
R6441:Myh2 UTSW 11 67,085,437 (GRCm39) missense probably benign 0.00
R6548:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6681:Myh2 UTSW 11 67,069,174 (GRCm39) missense probably damaging 1.00
R6907:Myh2 UTSW 11 67,084,567 (GRCm39) missense probably damaging 1.00
R6925:Myh2 UTSW 11 67,084,044 (GRCm39) missense probably benign 0.00
R6969:Myh2 UTSW 11 67,088,092 (GRCm39) missense probably benign
R7172:Myh2 UTSW 11 67,079,527 (GRCm39) missense probably benign 0.00
R7257:Myh2 UTSW 11 67,071,976 (GRCm39) missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67,079,195 (GRCm39) missense probably benign 0.23
R7323:Myh2 UTSW 11 67,088,191 (GRCm39) missense probably benign
R7396:Myh2 UTSW 11 67,085,554 (GRCm39) critical splice donor site probably null
R7468:Myh2 UTSW 11 67,083,368 (GRCm39) missense probably benign 0.01
R7585:Myh2 UTSW 11 67,070,237 (GRCm39) critical splice donor site probably null
R7709:Myh2 UTSW 11 67,085,690 (GRCm39) missense probably benign 0.00
R7859:Myh2 UTSW 11 67,077,526 (GRCm39) missense probably damaging 0.96
R7908:Myh2 UTSW 11 67,088,197 (GRCm39) missense probably benign
R8062:Myh2 UTSW 11 67,084,209 (GRCm39) nonsense probably null
R8065:Myh2 UTSW 11 67,072,170 (GRCm39) missense probably null 0.01
R8093:Myh2 UTSW 11 67,079,536 (GRCm39) missense probably damaging 1.00
R8123:Myh2 UTSW 11 67,064,135 (GRCm39) missense probably benign
R8235:Myh2 UTSW 11 67,083,824 (GRCm39) missense probably damaging 1.00
R8512:Myh2 UTSW 11 67,081,187 (GRCm39) missense probably benign 0.11
R8762:Myh2 UTSW 11 67,084,578 (GRCm39) missense probably damaging 1.00
R8777:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8777-TAIL:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8823:Myh2 UTSW 11 67,076,300 (GRCm39) missense probably damaging 1.00
R8927:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8928:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8978:Myh2 UTSW 11 67,080,323 (GRCm39) missense probably damaging 0.98
R8978:Myh2 UTSW 11 67,068,188 (GRCm39) missense probably damaging 0.96
R9228:Myh2 UTSW 11 67,077,522 (GRCm39) missense probably benign 0.11
R9332:Myh2 UTSW 11 67,070,209 (GRCm39) missense probably damaging 1.00
R9404:Myh2 UTSW 11 67,070,454 (GRCm39) missense probably damaging 1.00
R9430:Myh2 UTSW 11 67,070,359 (GRCm39) missense probably benign 0.01
R9445:Myh2 UTSW 11 67,069,754 (GRCm39) missense probably damaging 0.98
R9542:Myh2 UTSW 11 67,072,002 (GRCm39) missense possibly damaging 0.73
R9597:Myh2 UTSW 11 67,064,302 (GRCm39) missense possibly damaging 0.75
R9654:Myh2 UTSW 11 67,088,171 (GRCm39) missense probably benign
R9704:Myh2 UTSW 11 67,071,617 (GRCm39) missense possibly damaging 0.51
R9736:Myh2 UTSW 11 67,063,999 (GRCm39) missense probably benign 0.00
R9740:Myh2 UTSW 11 67,080,052 (GRCm39) missense probably damaging 0.99
X0026:Myh2 UTSW 11 67,065,848 (GRCm39) missense probably benign 0.10
X0065:Myh2 UTSW 11 67,067,085 (GRCm39) missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67,071,589 (GRCm39) critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67,082,275 (GRCm39) missense probably damaging 0.98
Z1177:Myh2 UTSW 11 67,084,084 (GRCm39) missense probably damaging 0.99
Z1177:Myh2 UTSW 11 67,066,997 (GRCm39) missense possibly damaging 0.86
Z1188:Myh2 UTSW 11 67,079,639 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTGATTTCCTCAGCCTTACCAGC -3'
(R):5'- TGAGTCCAAGACCTTGACTACCCC -3'

Sequencing Primer
(F):5'- CCTTACCAGCTAGTGAGGAATG -3'
(R):5'- GACTACCCCAAATTATGTTTGTGC -3'
Posted On 2013-06-11