Incidental Mutation 'R0555:Myh2'
ID45502
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67178967 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 380 (G380C)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: G380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: G380C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124337
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: G380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: G380C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.7678 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTGATTTCCTCAGCCTTACCAGC -3'
(R):5'- TGAGTCCAAGACCTTGACTACCCC -3'

Sequencing Primer
(F):5'- CCTTACCAGCTAGTGAGGAATG -3'
(R):5'- GACTACCCCAAATTATGTTTGTGC -3'
Posted On2013-06-11