Incidental Mutation 'R5858:Dock9'
ID455021
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 044070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5858 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121628792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 633 (V633A)
Ref Sequence ENSEMBL: ENSMUSP00000047881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: V633A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: V633A

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: V635A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: V635A

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: V633A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: V647A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,853,605 Q102L probably benign Het
Ak9 G A 10: 41,423,027 V1575I unknown Het
Alg14 G A 3: 121,320,088 probably benign Het
Arl5a T C 2: 52,412,106 I99V probably benign Het
Cacul1 T C 19: 60,529,044 probably benign Het
Cc2d2a C T 5: 43,715,775 R934C probably damaging Het
Ccr2 A G 9: 124,106,427 E248G probably benign Het
Cds2 G T 2: 132,302,113 V287L probably benign Het
Cflar T C 1: 58,753,851 S459P probably benign Het
Clcc1 A G 3: 108,661,428 D21G probably damaging Het
Col8a2 C T 4: 126,311,300 probably benign Het
Cops7a A T 6: 124,960,171 S186T possibly damaging Het
Dagla C T 19: 10,254,968 probably benign Het
Dapp1 T C 3: 137,961,531 Y49C possibly damaging Het
Dnase1 T C 16: 4,039,649 probably benign Het
E4f1 A G 17: 24,445,328 F461L probably damaging Het
Epg5 T A 18: 77,948,299 C70* probably null Het
Ephb2 T C 4: 136,672,445 H589R probably benign Het
Fam184b A T 5: 45,639,119 C41S probably damaging Het
Hace1 A G 10: 45,711,525 T907A possibly damaging Het
Il31 T A 5: 123,480,574 T129S probably benign Het
Il6 A T 5: 30,013,474 T23S possibly damaging Het
Kif12 T C 4: 63,166,410 E557G probably benign Het
Krt24 A T 11: 99,284,765 L148H probably damaging Het
Mapk8ip1 A G 2: 92,384,972 F635S probably damaging Het
Mcc A T 18: 44,510,141 V313E probably damaging Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Nbea A G 3: 55,953,034 probably null Het
Olfr1145 A T 2: 87,810,641 I274F probably benign Het
Olfr1442 A G 19: 12,674,379 Y58C probably damaging Het
Olfr165 A G 16: 19,407,225 S265P possibly damaging Het
Olfr705 T A 7: 106,873,768 Y159F probably benign Het
P4ha1 A T 10: 59,339,378 L53F probably damaging Het
Pcdha7 A G 18: 36,976,226 D768G probably damaging Het
Pdzd2 T A 15: 12,442,589 D208V probably damaging Het
Ptk2 A T 15: 73,321,095 I159K probably benign Het
Rfx6 A G 10: 51,725,868 N761S probably benign Het
Rpp25l A T 4: 41,712,678 D32E probably benign Het
Rxrg A T 1: 167,627,356 K169N probably damaging Het
Ryr2 T C 13: 11,560,574 D4846G probably damaging Het
Sec23a A G 12: 58,973,035 F553S probably damaging Het
Spen T C 4: 141,473,871 I2482V probably benign Het
Ston1 A G 17: 88,635,631 D155G possibly damaging Het
Tha1 A G 11: 117,873,384 F6L unknown Het
Trank1 T A 9: 111,392,536 D2780E probably benign Het
Ubqln5 T C 7: 104,128,811 T269A probably benign Het
Vars C T 17: 35,005,475 R324C probably benign Het
Zfp287 T A 11: 62,714,007 Q691H probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCTGCAGAGGTATGTAAG -3'
(R):5'- CTGTCCTGTGTAATAAACAGCC -3'

Sequencing Primer
(F):5'- CCTGCAGAGGTATGTAAGAGAAAG -3'
(R):5'- CCTCTGATCTGTGTCATTCG -3'
Posted On2017-02-10