Mutagenetix > Incidental Mutation

Incidental Mutation 'R0555:Zfyve16'

45509

Institutional Source

Beutler Lab

Gene Symbol

Zfyve16

Ensembl Gene

ENSMUSG00000021706

Gene Name

zinc finger, FYVE domain containing 16

Synonyms

B130024H06Rik

MMRRC Submission

038747-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R0555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92487108-92530868 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 92516520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022217]

AlphaFold

Q80U44

Predicted Effect

probably benign
Transcript: ENSMUST00000022217

SMART Domains

Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706

Domain	Start	End	E-Value	Type
low complexity region	163	175	N/A	INTRINSIC
low complexity region	367	381	N/A	INTRINSIC
low complexity region	438	449	N/A	INTRINSIC
low complexity region	455	484	N/A	INTRINSIC
low complexity region	569	580	N/A	INTRINSIC
FYVE	727	794	7.25e-31	SMART
low complexity region	821	838	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1050	1063	N/A	INTRINSIC
Pfam:DUF3480	1155	1503	3.3e-169	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156586

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gba2	C	A	4: 43,569,927	G429C	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
Greb1l	T	C	18: 10,458,781		probably benign	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Hoga1	A	C	19: 42,046,075	E53A	possibly damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Lrit3	A	T	3: 129,791,296	V271D	probably damaging	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mark4	A	C	7: 19,448,673		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het

Other mutations in Zfyve16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Zfyve16	APN	13	92516538	missense	possibly damaging	0.56
IGL00737:Zfyve16	APN	13	92521118	nonsense	probably null
IGL00741:Zfyve16	APN	13	92524253	missense	probably damaging	1.00
IGL00753:Zfyve16	APN	13	92521118	nonsense	probably null
IGL01123:Zfyve16	APN	13	92492522	missense	probably damaging	1.00
IGL01149:Zfyve16	APN	13	92508283	missense	probably damaging	1.00
IGL01414:Zfyve16	APN	13	92522196	missense	probably benign	0.04
IGL01771:Zfyve16	APN	13	92522172	missense	probably benign	0.38
IGL01889:Zfyve16	APN	13	92522569	missense	possibly damaging	0.87
IGL01928:Zfyve16	APN	13	92504498	missense	probably damaging	0.97
IGL02524:Zfyve16	APN	13	92504514	missense	probably benign	0.19
IGL03102:Zfyve16	APN	13	92511817	missense	possibly damaging	0.57
IGL03192:Zfyve16	APN	13	92521240	missense	possibly damaging	0.94
PIT4151001:Zfyve16	UTSW	13	92521204	missense	probably damaging	0.99
R0321:Zfyve16	UTSW	13	92492534	missense	probably damaging	0.99
R0548:Zfyve16	UTSW	13	92494944	missense	probably benign	0.00
R0616:Zfyve16	UTSW	13	92521129	missense	probably damaging	1.00
R0727:Zfyve16	UTSW	13	92493878	missense	possibly damaging	0.81
R0730:Zfyve16	UTSW	13	92521477	missense	probably damaging	0.98
R1221:Zfyve16	UTSW	13	92508305	missense	possibly damaging	0.87
R1297:Zfyve16	UTSW	13	92522332	missense	probably benign	0.41
R1597:Zfyve16	UTSW	13	92508247	missense	probably benign	0.02
R1635:Zfyve16	UTSW	13	92509020	missense	probably damaging	1.00
R1803:Zfyve16	UTSW	13	92504085	missense	probably damaging	1.00
R1840:Zfyve16	UTSW	13	92511525	missense	possibly damaging	0.79
R1962:Zfyve16	UTSW	13	92522744	missense	possibly damaging	0.74
R2029:Zfyve16	UTSW	13	92504477	missense	probably damaging	0.98
R2083:Zfyve16	UTSW	13	92524262	missense	probably damaging	1.00
R2122:Zfyve16	UTSW	13	92519483	nonsense	probably null
R2173:Zfyve16	UTSW	13	92495088	missense	probably damaging	0.99
R3822:Zfyve16	UTSW	13	92521261	missense	probably damaging	1.00
R3857:Zfyve16	UTSW	13	92494971	missense	probably damaging	1.00
R4043:Zfyve16	UTSW	13	92513763	splice site	probably null
R4056:Zfyve16	UTSW	13	92504549	missense	probably damaging	1.00
R4495:Zfyve16	UTSW	13	92488567	missense	probably benign	0.25
R4518:Zfyve16	UTSW	13	92521312	missense	possibly damaging	0.86
R4835:Zfyve16	UTSW	13	92522185	missense	probably benign	0.18
R4862:Zfyve16	UTSW	13	92508256	missense	probably damaging	1.00
R4962:Zfyve16	UTSW	13	92513894	missense	probably damaging	1.00
R5117:Zfyve16	UTSW	13	92505689	missense	possibly damaging	0.95
R5344:Zfyve16	UTSW	13	92521588	missense	possibly damaging	0.79
R5358:Zfyve16	UTSW	13	92508263	missense	probably benign	0.04
R5407:Zfyve16	UTSW	13	92500284	missense	probably damaging	1.00
R5410:Zfyve16	UTSW	13	92521231	missense	probably benign	0.08
R5704:Zfyve16	UTSW	13	92504471	splice site	probably null
R5731:Zfyve16	UTSW	13	92508193	missense	probably benign	0.11
R5808:Zfyve16	UTSW	13	92495055	nonsense	probably null
R5828:Zfyve16	UTSW	13	92513902	missense	probably damaging	1.00
R5928:Zfyve16	UTSW	13	92522117	missense	probably benign	0.01
R6044:Zfyve16	UTSW	13	92522666	nonsense	probably null
R6141:Zfyve16	UTSW	13	92511597	missense	probably benign	0.00
R6538:Zfyve16	UTSW	13	92504516	missense	probably damaging	1.00
R6594:Zfyve16	UTSW	13	92513818	missense	probably benign	0.23
R6767:Zfyve16	UTSW	13	92508199	missense	probably damaging	1.00
R6942:Zfyve16	UTSW	13	92516631	missense	probably benign
R7011:Zfyve16	UTSW	13	92521987	missense	probably benign	0.00
R7381:Zfyve16	UTSW	13	92521146	missense	probably damaging	1.00
R7531:Zfyve16	UTSW	13	92522965	missense	probably damaging	1.00
R7617:Zfyve16	UTSW	13	92504562	missense	probably damaging	1.00
R7831:Zfyve16	UTSW	13	92522328	missense	probably benign	0.05
R8127:Zfyve16	UTSW	13	92505677	missense	probably damaging	1.00
R8382:Zfyve16	UTSW	13	92513820	missense	probably benign
R8467:Zfyve16	UTSW	13	92508282	missense	probably damaging	1.00
R8765:Zfyve16	UTSW	13	92521547	missense	probably benign	0.15
R8792:Zfyve16	UTSW	13	92523161	missense	probably benign	0.08
R9112:Zfyve16	UTSW	13	92523055	missense	possibly damaging	0.75
R9169:Zfyve16	UTSW	13	92521363	missense	probably damaging	1.00
R9599:Zfyve16	UTSW	13	92500255	missense	probably damaging	1.00
R9608:Zfyve16	UTSW	13	92500280	missense	probably damaging	1.00
R9636:Zfyve16	UTSW	13	92494948	missense	probably benign	0.17
R9669:Zfyve16	UTSW	13	92519499	missense	probably damaging	0.99
R9685:Zfyve16	UTSW	13	92522803	missense	possibly damaging	0.75
Z1176:Zfyve16	UTSW	13	92492663	missense	possibly damaging	0.95
Z1177:Zfyve16	UTSW	13	92522996	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAGTCCCATGACTGTCAGCACTCC -3'
(R):5'- GACATCTTTGCCAAGTGCCACTTTC -3'

Sequencing Primer
(F):5'- cttttccctccttccaccc -3'
(R):5'- CCCTTTATAGCTCAGGCATTTG -3'

Posted On

2013-06-11