Incidental Mutation 'R5870:Prg4'
ID 455096
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms MSF, SZP, lubricin, DOL54
MMRRC Submission 044078-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R5870 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150325163-150341916 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 150331300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 458 (K458*)
Ref Sequence ENSEMBL: ENSMUSP00000128943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000164600]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111901
AA Change: K370*
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: K370*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111902
AA Change: K417*
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: K417*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161611
AA Change: K458*
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: K458*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164600
AA Change: K458*
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: K458*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,236,232 (GRCm39) V156A probably damaging Het
Ak6 C A 13: 100,791,932 (GRCm39) P125Q probably damaging Het
Aqp4 A C 18: 15,532,946 (GRCm39) V49G probably damaging Het
Arfgef1 A G 1: 10,251,163 (GRCm39) I874T probably damaging Het
Arid1a T C 4: 133,408,387 (GRCm39) D2040G unknown Het
Atp1a3 T G 7: 24,697,003 (GRCm39) D220A probably benign Het
C2cd4c A T 10: 79,448,043 (GRCm39) I368N possibly damaging Het
Ccnt1 G A 15: 98,441,394 (GRCm39) Q625* probably null Het
Cd177 T A 7: 24,455,757 (GRCm39) H255L probably benign Het
Cdipt G A 7: 126,578,094 (GRCm39) V114M probably benign Het
Coro1b T A 19: 4,199,384 (GRCm39) H14Q probably damaging Het
Ctdp1 T A 18: 80,451,901 (GRCm39) D158V unknown Het
Cts7 A T 13: 61,503,545 (GRCm39) S140T probably damaging Het
Dlgap3 T A 4: 127,089,502 (GRCm39) L366* probably null Het
Dnah9 C T 11: 65,976,036 (GRCm39) A1338T probably benign Het
Dock7 T C 4: 98,952,199 (GRCm39) I424V probably benign Het
Dock8 G T 19: 25,109,490 (GRCm39) A891S probably benign Het
Dync2i1 A G 12: 116,219,865 (GRCm39) S26P possibly damaging Het
Elmod3 A G 6: 72,571,721 (GRCm39) probably null Het
Eps15 G A 4: 109,218,507 (GRCm39) E107K probably damaging Het
Esco1 A T 18: 10,593,744 (GRCm39) probably null Het
Fuz A G 7: 44,549,742 (GRCm39) T407A probably damaging Het
Galr1 A T 18: 82,424,197 (GRCm39) F27I probably benign Het
Glt1d1 A G 5: 127,754,344 (GRCm39) Y182C probably damaging Het
Gm37240 A T 3: 84,597,828 (GRCm39) probably benign Het
Gm37610 A G 6: 41,061,848 (GRCm39) noncoding transcript Het
Gm6658 G T 8: 91,635,020 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,789 (GRCm39) T74A possibly damaging Het
Hadha G A 5: 30,349,284 (GRCm39) S109F possibly damaging Het
Herc3 A T 6: 58,893,435 (GRCm39) Q899L probably benign Het
Ift172 C T 5: 31,434,284 (GRCm39) E485K probably benign Het
Lrrc8e A G 8: 4,285,725 (GRCm39) K650R possibly damaging Het
Ly6d A T 15: 74,635,381 (GRCm39) V10D possibly damaging Het
Med27 A G 2: 29,279,823 (GRCm39) probably null Het
Med29 A T 7: 28,091,922 (GRCm39) V56E probably damaging Het
Mobp A G 9: 119,996,919 (GRCm39) K17E probably damaging Het
Mrpl37 G A 4: 106,923,919 (GRCm39) T25I probably benign Het
Myh1 A G 11: 67,092,805 (GRCm39) D33G possibly damaging Het
Nrg3 T A 14: 39,194,586 (GRCm39) I58F possibly damaging Het
Or52e2 A G 7: 102,804,948 (GRCm39) I2T probably benign Het
Or7e176 A G 9: 20,171,874 (GRCm39) D246G probably benign Het
Padi1 T A 4: 140,553,892 (GRCm39) D359V probably benign Het
Pcdh7 T C 5: 57,877,753 (GRCm39) V436A possibly damaging Het
Pgm3 C A 9: 86,452,414 (GRCm39) K15N probably damaging Het
Phip A T 9: 82,790,730 (GRCm39) probably benign Het
Pot1a G A 6: 25,778,950 (GRCm39) T48I possibly damaging Het
Ppic T C 18: 53,542,333 (GRCm39) K125R probably benign Het
Ppm1j T C 3: 104,692,811 (GRCm39) V440A possibly damaging Het
Rd3 A T 1: 191,717,261 (GRCm39) M244L probably benign Het
Rflnb A G 11: 75,912,864 (GRCm39) Y175H probably benign Het
Rnf157 T A 11: 116,237,900 (GRCm39) S574C probably benign Het
Sardh A G 2: 27,110,653 (GRCm39) probably null Het
Senp3 C T 11: 69,569,048 (GRCm39) probably null Het
Siglec1 G A 2: 130,914,767 (GRCm39) R1450C probably damaging Het
Sim2 A G 16: 93,924,193 (GRCm39) H446R probably damaging Het
Spon1 T C 7: 113,631,021 (GRCm39) I444T probably damaging Het
Srebf1 T A 11: 60,094,410 (GRCm39) Q568H possibly damaging Het
Stxbp4 A T 11: 90,428,782 (GRCm39) I441N possibly damaging Het
Sugt1 G A 14: 79,846,451 (GRCm39) V163I probably benign Het
Surf1 G T 2: 26,806,271 (GRCm39) probably benign Het
Synj2 A G 17: 6,088,128 (GRCm39) E1348G probably benign Het
Tc2n A T 12: 101,619,111 (GRCm39) V349D probably damaging Het
Ten1 A G 11: 116,105,751 (GRCm39) R112G possibly damaging Het
Tm9sf4 A G 2: 153,036,201 (GRCm39) D321G probably damaging Het
Ttll12 A T 15: 83,461,237 (GRCm39) M594K probably damaging Het
Ttn T A 2: 76,703,058 (GRCm39) probably benign Het
Usp28 C T 9: 48,937,285 (GRCm39) Q185* probably null Het
Vmn2r112 A G 17: 22,838,004 (GRCm39) I822V probably benign Het
Zc3hc1 A T 6: 30,382,682 (GRCm39) L88* probably null Het
Zfr T A 15: 12,160,701 (GRCm39) V758D probably damaging Het
Zfyve27 T G 19: 42,160,110 (GRCm39) L42R probably benign Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150,327,671 (GRCm39) missense probably damaging 0.99
IGL02033:Prg4 APN 1 150,331,619 (GRCm39) intron probably benign
IGL02154:Prg4 APN 1 150,330,613 (GRCm39) intron probably benign
IGL03111:Prg4 APN 1 150,327,653 (GRCm39) missense probably benign 0.06
IGL03177:Prg4 APN 1 150,331,354 (GRCm39) intron probably benign
IGL03260:Prg4 APN 1 150,331,378 (GRCm39) intron probably benign
IGL03281:Prg4 APN 1 150,325,839 (GRCm39) splice site probably benign
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
R0233:Prg4 UTSW 1 150,329,298 (GRCm39) splice site probably benign
R0255:Prg4 UTSW 1 150,331,558 (GRCm39) intron probably benign
R0616:Prg4 UTSW 1 150,336,462 (GRCm39) missense probably damaging 1.00
R1016:Prg4 UTSW 1 150,330,442 (GRCm39) intron probably benign
R1826:Prg4 UTSW 1 150,327,760 (GRCm39) missense probably benign 0.09
R1862:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1863:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1922:Prg4 UTSW 1 150,325,750 (GRCm39) nonsense probably null
R1940:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150,327,122 (GRCm39) missense probably damaging 0.97
R3855:Prg4 UTSW 1 150,327,751 (GRCm39) missense probably damaging 1.00
R3894:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3895:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3912:Prg4 UTSW 1 150,327,619 (GRCm39) missense probably damaging 1.00
R3935:Prg4 UTSW 1 150,333,908 (GRCm39) missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R4475:Prg4 UTSW 1 150,330,610 (GRCm39) intron probably benign
R4794:Prg4 UTSW 1 150,330,297 (GRCm39) intron probably benign
R4910:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4911:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4993:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R5378:Prg4 UTSW 1 150,330,977 (GRCm39) intron probably benign
R5381:Prg4 UTSW 1 150,330,204 (GRCm39) intron probably benign
R5452:Prg4 UTSW 1 150,331,519 (GRCm39) intron probably benign
R5888:Prg4 UTSW 1 150,328,101 (GRCm39) missense probably damaging 1.00
R5929:Prg4 UTSW 1 150,329,880 (GRCm39) missense probably benign 0.01
R6058:Prg4 UTSW 1 150,327,197 (GRCm39) missense probably damaging 0.99
R6059:Prg4 UTSW 1 150,325,748 (GRCm39) missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150,331,567 (GRCm39) intron probably benign
R6272:Prg4 UTSW 1 150,330,517 (GRCm39) intron probably benign
R6459:Prg4 UTSW 1 150,330,052 (GRCm39) intron probably benign
R6659:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R6663:Prg4 UTSW 1 150,330,852 (GRCm39) intron probably benign
R6882:Prg4 UTSW 1 150,329,246 (GRCm39) missense probably damaging 1.00
R6970:Prg4 UTSW 1 150,331,657 (GRCm39) intron probably benign
R7078:Prg4 UTSW 1 150,334,014 (GRCm39) missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150,328,005 (GRCm39) missense probably damaging 1.00
R7264:Prg4 UTSW 1 150,329,818 (GRCm39) missense not run
R7487:Prg4 UTSW 1 150,331,656 (GRCm39) missense unknown
R7531:Prg4 UTSW 1 150,330,786 (GRCm39) missense unknown
R7651:Prg4 UTSW 1 150,330,696 (GRCm39) missense unknown
R7701:Prg4 UTSW 1 150,333,293 (GRCm39) missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150,331,601 (GRCm39) missense unknown
R8248:Prg4 UTSW 1 150,330,877 (GRCm39) missense unknown
R8436:Prg4 UTSW 1 150,331,318 (GRCm39) missense unknown
R8460:Prg4 UTSW 1 150,331,692 (GRCm39) missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150,330,396 (GRCm39) missense unknown
R8904:Prg4 UTSW 1 150,331,810 (GRCm39) missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9073:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9274:Prg4 UTSW 1 150,331,924 (GRCm39) missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150,327,116 (GRCm39) missense probably damaging 1.00
R9488:Prg4 UTSW 1 150,327,024 (GRCm39) missense probably benign
R9613:Prg4 UTSW 1 150,331,660 (GRCm39) missense unknown
R9670:Prg4 UTSW 1 150,326,618 (GRCm39) missense probably benign 0.01
X0024:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTGTGGGTTCAGGCTCC -3'
(R):5'- TCCCAAGGAGCCTGAACC -3'

Sequencing Primer
(F):5'- AGTTGTGGGTTCAGGCTCC -3'
(R):5'- GGAGCCTGAACCCACAACTC -3'
Posted On 2017-02-10