Incidental Mutation 'R5870:Med27'
ID455098
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Namemediator complex subunit 27
SynonymsD2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29346819-29524793 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 29389811 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000113830] [ENSMUST00000159034] [ENSMUST00000159034] [ENSMUST00000159034] [ENSMUST00000159280] [ENSMUST00000162597] [ENSMUST00000162623]
Predicted Effect probably benign
Transcript: ENSMUST00000028139
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153600
Predicted Effect probably null
Transcript: ENSMUST00000159034
Predicted Effect probably null
Transcript: ENSMUST00000159034
Predicted Effect probably null
Transcript: ENSMUST00000159034
Predicted Effect probably benign
Transcript: ENSMUST00000159280
SMART Domains Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 85 171 1.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162597
Predicted Effect probably null
Transcript: ENSMUST00000162603
Predicted Effect probably null
Transcript: ENSMUST00000162603
Predicted Effect probably null
Transcript: ENSMUST00000162603
Predicted Effect probably benign
Transcript: ENSMUST00000162623
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R0427:Med27 UTSW 2 29500271 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R3196:Med27 UTSW 2 29346870 missense possibly damaging 0.86
R4093:Med27 UTSW 2 29377908 unclassified probably benign
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R6061:Med27 UTSW 2 29509441 missense probably damaging 0.99
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
R7671:Med27 UTSW 2 29377938 missense
R8255:Med27 UTSW 2 29524364 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCCCAGTGTGCACTAAC -3'
(R):5'- ATCGTGAACCTCATGGAGC -3'

Sequencing Primer
(F):5'- CCCTGCTGTAAGTTCATAGATAAAGG -3'
(R):5'- GTGAACCTCATGGAGCTACATCTTAC -3'
Posted On2017-02-10