Incidental Mutation 'R5870:Dock7'
ID 455107
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission 044078-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5870 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98952199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 424 (I424V)
Ref Sequence ENSEMBL: ENSMUSP00000075233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: I424V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: I424V

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
AA Change: I424V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: I424V

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127417
AA Change: I424V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: I424V

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205650
AA Change: I424V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206604
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,236,232 (GRCm39) V156A probably damaging Het
Ak6 C A 13: 100,791,932 (GRCm39) P125Q probably damaging Het
Aqp4 A C 18: 15,532,946 (GRCm39) V49G probably damaging Het
Arfgef1 A G 1: 10,251,163 (GRCm39) I874T probably damaging Het
Arid1a T C 4: 133,408,387 (GRCm39) D2040G unknown Het
Atp1a3 T G 7: 24,697,003 (GRCm39) D220A probably benign Het
C2cd4c A T 10: 79,448,043 (GRCm39) I368N possibly damaging Het
Ccnt1 G A 15: 98,441,394 (GRCm39) Q625* probably null Het
Cd177 T A 7: 24,455,757 (GRCm39) H255L probably benign Het
Cdipt G A 7: 126,578,094 (GRCm39) V114M probably benign Het
Coro1b T A 19: 4,199,384 (GRCm39) H14Q probably damaging Het
Ctdp1 T A 18: 80,451,901 (GRCm39) D158V unknown Het
Cts7 A T 13: 61,503,545 (GRCm39) S140T probably damaging Het
Dlgap3 T A 4: 127,089,502 (GRCm39) L366* probably null Het
Dnah9 C T 11: 65,976,036 (GRCm39) A1338T probably benign Het
Dock8 G T 19: 25,109,490 (GRCm39) A891S probably benign Het
Dync2i1 A G 12: 116,219,865 (GRCm39) S26P possibly damaging Het
Elmod3 A G 6: 72,571,721 (GRCm39) probably null Het
Eps15 G A 4: 109,218,507 (GRCm39) E107K probably damaging Het
Esco1 A T 18: 10,593,744 (GRCm39) probably null Het
Fuz A G 7: 44,549,742 (GRCm39) T407A probably damaging Het
Galr1 A T 18: 82,424,197 (GRCm39) F27I probably benign Het
Glt1d1 A G 5: 127,754,344 (GRCm39) Y182C probably damaging Het
Gm37240 A T 3: 84,597,828 (GRCm39) probably benign Het
Gm37610 A G 6: 41,061,848 (GRCm39) noncoding transcript Het
Gm6658 G T 8: 91,635,020 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,789 (GRCm39) T74A possibly damaging Het
Hadha G A 5: 30,349,284 (GRCm39) S109F possibly damaging Het
Herc3 A T 6: 58,893,435 (GRCm39) Q899L probably benign Het
Ift172 C T 5: 31,434,284 (GRCm39) E485K probably benign Het
Lrrc8e A G 8: 4,285,725 (GRCm39) K650R possibly damaging Het
Ly6d A T 15: 74,635,381 (GRCm39) V10D possibly damaging Het
Med27 A G 2: 29,279,823 (GRCm39) probably null Het
Med29 A T 7: 28,091,922 (GRCm39) V56E probably damaging Het
Mobp A G 9: 119,996,919 (GRCm39) K17E probably damaging Het
Mrpl37 G A 4: 106,923,919 (GRCm39) T25I probably benign Het
Myh1 A G 11: 67,092,805 (GRCm39) D33G possibly damaging Het
Nrg3 T A 14: 39,194,586 (GRCm39) I58F possibly damaging Het
Or52e2 A G 7: 102,804,948 (GRCm39) I2T probably benign Het
Or7e176 A G 9: 20,171,874 (GRCm39) D246G probably benign Het
Padi1 T A 4: 140,553,892 (GRCm39) D359V probably benign Het
Pcdh7 T C 5: 57,877,753 (GRCm39) V436A possibly damaging Het
Pgm3 C A 9: 86,452,414 (GRCm39) K15N probably damaging Het
Phip A T 9: 82,790,730 (GRCm39) probably benign Het
Pot1a G A 6: 25,778,950 (GRCm39) T48I possibly damaging Het
Ppic T C 18: 53,542,333 (GRCm39) K125R probably benign Het
Ppm1j T C 3: 104,692,811 (GRCm39) V440A possibly damaging Het
Prg4 T A 1: 150,331,300 (GRCm39) K458* probably null Het
Rd3 A T 1: 191,717,261 (GRCm39) M244L probably benign Het
Rflnb A G 11: 75,912,864 (GRCm39) Y175H probably benign Het
Rnf157 T A 11: 116,237,900 (GRCm39) S574C probably benign Het
Sardh A G 2: 27,110,653 (GRCm39) probably null Het
Senp3 C T 11: 69,569,048 (GRCm39) probably null Het
Siglec1 G A 2: 130,914,767 (GRCm39) R1450C probably damaging Het
Sim2 A G 16: 93,924,193 (GRCm39) H446R probably damaging Het
Spon1 T C 7: 113,631,021 (GRCm39) I444T probably damaging Het
Srebf1 T A 11: 60,094,410 (GRCm39) Q568H possibly damaging Het
Stxbp4 A T 11: 90,428,782 (GRCm39) I441N possibly damaging Het
Sugt1 G A 14: 79,846,451 (GRCm39) V163I probably benign Het
Surf1 G T 2: 26,806,271 (GRCm39) probably benign Het
Synj2 A G 17: 6,088,128 (GRCm39) E1348G probably benign Het
Tc2n A T 12: 101,619,111 (GRCm39) V349D probably damaging Het
Ten1 A G 11: 116,105,751 (GRCm39) R112G possibly damaging Het
Tm9sf4 A G 2: 153,036,201 (GRCm39) D321G probably damaging Het
Ttll12 A T 15: 83,461,237 (GRCm39) M594K probably damaging Het
Ttn T A 2: 76,703,058 (GRCm39) probably benign Het
Usp28 C T 9: 48,937,285 (GRCm39) Q185* probably null Het
Vmn2r112 A G 17: 22,838,004 (GRCm39) I822V probably benign Het
Zc3hc1 A T 6: 30,382,682 (GRCm39) L88* probably null Het
Zfr T A 15: 12,160,701 (GRCm39) V758D probably damaging Het
Zfyve27 T G 19: 42,160,110 (GRCm39) L42R probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2020:Dock7 UTSW 4 98,847,338 (GRCm39) missense probably damaging 1.00
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4261:Dock7 UTSW 4 98,892,123 (GRCm39) missense possibly damaging 0.78
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7729:Dock7 UTSW 4 98,943,683 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9160:Dock7 UTSW 4 98,857,962 (GRCm39) missense unknown
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9450:Dock7 UTSW 4 98,861,426 (GRCm39) missense unknown
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGCCTCAGGAATGAAGCC -3'
(R):5'- GTGAAATAGCCCTTAGGTTGTGTC -3'

Sequencing Primer
(F):5'- CAGGAATGAAGCCTGCACTGC -3'
(R):5'- ATAGCCCTTAGGTTGTGTCTTTCAAG -3'
Posted On 2017-02-10