Incidental Mutation 'R5870:Padi1'
ID455112
Institutional Source Beutler Lab
Gene Symbol Padi1
Ensembl Gene ENSMUSG00000025329
Gene Namepeptidyl arginine deiminase, type I
SynonymsPad type 1, Pdi1
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140812983-140845778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140826581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 359 (D359V)
Ref Sequence ENSEMBL: ENSMUSP00000026378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026378]
Predicted Effect probably benign
Transcript: ENSMUST00000026378
AA Change: D359V

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329
AA Change: D359V

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Padi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Padi1 APN 4 140829435 missense probably damaging 1.00
IGL01972:Padi1 APN 4 140818859 splice site probably benign
IGL03260:Padi1 APN 4 140828194 missense probably benign 0.11
R0598:Padi1 UTSW 4 140814787 missense possibly damaging 0.84
R1164:Padi1 UTSW 4 140832329 missense possibly damaging 0.50
R1793:Padi1 UTSW 4 140814656 missense probably damaging 1.00
R4208:Padi1 UTSW 4 140817227 missense possibly damaging 0.80
R4256:Padi1 UTSW 4 140814778 missense probably damaging 1.00
R4484:Padi1 UTSW 4 140817270 intron probably benign
R4926:Padi1 UTSW 4 140824847 missense probably damaging 0.99
R4967:Padi1 UTSW 4 140845590 missense probably benign 0.00
R5066:Padi1 UTSW 4 140829437 missense probably damaging 1.00
R5523:Padi1 UTSW 4 140814853 missense probably damaging 1.00
R5622:Padi1 UTSW 4 140824955 missense probably damaging 1.00
R5850:Padi1 UTSW 4 140814830 missense probably benign 0.03
R5951:Padi1 UTSW 4 140814829 missense probably damaging 1.00
R6187:Padi1 UTSW 4 140826965 missense probably damaging 1.00
R7257:Padi1 UTSW 4 140829471 missense probably damaging 1.00
R7326:Padi1 UTSW 4 140832404 missense probably benign 0.15
R7339:Padi1 UTSW 4 140829234 missense probably null 0.98
R8282:Padi1 UTSW 4 140814703 missense probably damaging 1.00
X0024:Padi1 UTSW 4 140828167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACCCTAAAGTTCCACCAG -3'
(R):5'- TGTGCAAGGCTGACACAGAG -3'

Sequencing Primer
(F):5'- TAAAGTTCCACCAGGGCTCC -3'
(R):5'- TAGGTGACAGCCTGGCCTG -3'
Posted On2017-02-10