Incidental Mutation 'R5870:Hadha'
ID455113
Institutional Source Beutler Lab
Gene Symbol Hadha
Ensembl Gene ENSMUSG00000025745
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
SynonymsMtpa
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30118304-30155162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30144286 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 109 (S109F)
Ref Sequence ENSEMBL: ENSMUSP00000120976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156859]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130358
Predicted Effect possibly damaging
Transcript: ENSMUST00000156859
AA Change: S109F

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745
AA Change: S109F

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199559
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within 36 hours with hypoglycemia and liver steatosis. Liver steatosis and insulin resistance develop in heterozygotes with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Hadha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Hadha APN 5 30120147 missense possibly damaging 0.94
IGL00435:Hadha APN 5 30122173 missense probably benign 0.12
IGL01413:Hadha APN 5 30141027 missense probably benign 0.01
IGL01715:Hadha APN 5 30120084 missense probably damaging 1.00
IGL02065:Hadha APN 5 30142845 splice site probably benign
IGL02316:Hadha APN 5 30126567 missense probably benign 0.04
IGL02366:Hadha APN 5 30135050 missense probably benign 0.01
IGL02453:Hadha APN 5 30144306 splice site probably benign
IGL02611:Hadha APN 5 30128943 splice site probably benign
IGL03127:Hadha APN 5 30134186 splice site probably benign
IGL03181:Hadha APN 5 30121526 missense probably benign 0.20
R1381:Hadha UTSW 5 30128836 missense probably benign
R1501:Hadha UTSW 5 30128806 missense probably benign 0.02
R2060:Hadha UTSW 5 30128836 missense probably benign 0.30
R3764:Hadha UTSW 5 30144209 missense probably damaging 1.00
R3778:Hadha UTSW 5 30120129 missense probably damaging 0.98
R5025:Hadha UTSW 5 30154961 unclassified probably benign
R5523:Hadha UTSW 5 30145254 missense possibly damaging 0.78
R6054:Hadha UTSW 5 30123684 missense probably benign 0.00
R6144:Hadha UTSW 5 30140996 missense probably benign 0.04
R6245:Hadha UTSW 5 30120044 critical splice donor site probably null
R6495:Hadha UTSW 5 30120050 missense probably benign 0.03
R6862:Hadha UTSW 5 30147979 critical splice donor site probably null
R7038:Hadha UTSW 5 30120000 splice site probably null
R7200:Hadha UTSW 5 30145317 missense probably benign 0.25
R7215:Hadha UTSW 5 30119842 missense probably benign 0.00
R7267:Hadha UTSW 5 30122757 missense probably damaging 1.00
R7414:Hadha UTSW 5 30126612 missense possibly damaging 0.95
R8172:Hadha UTSW 5 30145287 missense probably damaging 0.97
R8429:Hadha UTSW 5 30144257 missense probably benign 0.00
R8516:Hadha UTSW 5 30126584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCAGGCATTTGACAGCTG -3'
(R):5'- GTGCTCAATAGTTTGTTACAGAGC -3'

Sequencing Primer
(F):5'- CTAAAGGGCTCTGGTGGCAG -3'
(R):5'- GCAAAGTAAATTGTGTAACCTGTTCC -3'
Posted On2017-02-10