Mutagenetix > Incidental Mutation

Incidental Mutation 'R5870:Cd177'

455122

Institutional Source

Beutler Lab

Gene Symbol

Cd177

Ensembl Gene

ENSMUSG00000052212

Gene Name

CD177 antigen

Synonyms

Pdp3, 1190003K14Rik

MMRRC Submission

044078-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.501) question?

Stock #

R5870 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

24743983-24760311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24756332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 255 (H255L)

Ref Sequence

ENSEMBL: ENSMUSP00000064934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063956]

AlphaFold

Q8R2S8

Predicted Effect

probably benign
Transcript: ENSMUST00000063956
AA Change: H255L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: H255L

Domain	Start	End	E-Value	Type
Pfam:UPAR_LY6	134	214	3.7e-11	PFAM
Pfam:UPAR_LY6	226	300	1.2e-4	PFAM
low complexity region	301	317	N/A	INTRINSIC
Pfam:UPAR_LY6	322	400	1.5e-9	PFAM
Pfam:UPAR_LY6	511	586	9.1e-12	PFAM
Pfam:UPAR_LY6	705	782	1.4e-11	PFAM
low complexity region	795	811	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

93% (84/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	G	16: 4,418,368	V156A	probably damaging	Het
Ak6	C	A	13: 100,655,424	P125Q	probably damaging	Het
Aqp4	A	C	18: 15,399,889	V49G	probably damaging	Het
Arfgef1	A	G	1: 10,180,938	I874T	probably damaging	Het
Arid1a	T	C	4: 133,681,076	D2040G	unknown	Het
Atp1a3	T	G	7: 24,997,578	D220A	probably benign	Het
C2cd4c	A	T	10: 79,612,209	I368N	possibly damaging	Het
Ccnt1	G	A	15: 98,543,513	Q625*	probably null	Het
Cdipt	G	A	7: 126,978,922	V114M	probably benign	Het
Coro1b	T	A	19: 4,149,385	H14Q	probably damaging	Het
Ctdp1	T	A	18: 80,408,686	D158V	unknown	Het
Cts7	A	T	13: 61,355,731	S140T	probably damaging	Het
Dlgap3	T	A	4: 127,195,709	L366*	probably null	Het
Dnah9	C	T	11: 66,085,210	A1338T	probably benign	Het
Dock7	T	C	4: 99,063,962	I424V	probably benign	Het
Dock8	G	T	19: 25,132,126	A891S	probably benign	Het
Elmod3	A	G	6: 72,594,738		probably null	Het
Eps15	G	A	4: 109,361,310	E107K	probably damaging	Het
Esco1	A	T	18: 10,593,744		probably null	Het
Fuz	A	G	7: 44,900,318	T407A	probably damaging	Het
Galr1	A	T	18: 82,406,072	F27I	probably benign	Het
Glt1d1	A	G	5: 127,677,280	Y182C	probably damaging	Het
Gm37240	A	T	3: 84,690,521		probably benign	Het
Gm37610	A	G	6: 41,084,914		noncoding transcript	Het
Gm6658	G	T	8: 90,908,392		probably benign	Het
Gm9376	A	G	14: 118,267,377	T74A	possibly damaging	Het
Hadha	G	A	5: 30,144,286	S109F	possibly damaging	Het
Herc3	A	T	6: 58,916,450	Q899L	probably benign	Het
Ift172	C	T	5: 31,276,940	E485K	probably benign	Het
Lrrc8e	A	G	8: 4,235,725	K650R	possibly damaging	Het
Ly6d	A	T	15: 74,763,532	V10D	possibly damaging	Het
Med27	A	G	2: 29,389,811		probably null	Het
Med29	A	T	7: 28,392,497	V56E	probably damaging	Het
Mobp	A	G	9: 120,167,853	K17E	probably damaging	Het
Mrpl37	G	A	4: 107,066,722	T25I	probably benign	Het
Myh1	A	G	11: 67,201,979	D33G	possibly damaging	Het
Nrg3	T	A	14: 39,472,629	I58F	possibly damaging	Het
Olfr589	A	G	7: 103,155,741	I2T	probably benign	Het
Olfr872	A	G	9: 20,260,578	D246G	probably benign	Het
Padi1	T	A	4: 140,826,581	D359V	probably benign	Het
Pcdh7	T	C	5: 57,720,411	V436A	possibly damaging	Het
Pgm3	C	A	9: 86,570,361	K15N	probably damaging	Het
Phip	A	T	9: 82,908,677		probably benign	Het
Pot1a	G	A	6: 25,778,951	T48I	possibly damaging	Het
Ppic	T	C	18: 53,409,261	K125R	probably benign	Het
Ppm1j	T	C	3: 104,785,495	V440A	possibly damaging	Het
Prg4	T	A	1: 150,455,549	K458*	probably null	Het
Rd3	A	T	1: 191,985,300	M244L	probably benign	Het
Rflnb	A	G	11: 76,022,038	Y175H	probably benign	Het
Rnf157	T	A	11: 116,347,074	S574C	probably benign	Het
Sardh	A	G	2: 27,220,641		probably null	Het
Senp3	C	T	11: 69,678,222		probably null	Het
Siglec1	G	A	2: 131,072,847	R1450C	probably damaging	Het
Sim2	A	G	16: 94,123,334	H446R	probably damaging	Het
Spon1	T	C	7: 114,031,786	I444T	probably damaging	Het
Srebf1	T	A	11: 60,203,584	Q568H	possibly damaging	Het
Stxbp4	A	T	11: 90,537,956	I441N	possibly damaging	Het
Sugt1	G	A	14: 79,609,011	V163I	probably benign	Het
Surf1	G	T	2: 26,916,259		probably benign	Het
Synj2	A	G	17: 6,037,853	E1348G	probably benign	Het
Tc2n	A	T	12: 101,652,852	V349D	probably damaging	Het
Ten1	A	G	11: 116,214,925	R112G	possibly damaging	Het
Tm9sf4	A	G	2: 153,194,281	D321G	probably damaging	Het
Ttll12	A	T	15: 83,577,036	M594K	probably damaging	Het
Ttn	T	A	2: 76,872,714		probably benign	Het
Usp28	C	T	9: 49,025,985	Q185*	probably null	Het
Vmn2r112	A	G	17: 22,619,023	I822V	probably benign	Het
Wdr60	A	G	12: 116,256,245	S26P	possibly damaging	Het
Zc3hc1	A	T	6: 30,382,683	L88*	probably null	Het
Zfr	T	A	15: 12,160,615	V758D	probably damaging	Het
Zfyve27	T	G	19: 42,171,671	L42R	probably benign	Het

Other mutations in Cd177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cd177	APN	7	24759751	missense	possibly damaging	0.59
IGL00479:Cd177	APN	7	24758015	missense	probably benign	0.05
IGL00673:Cd177	APN	7	24752017	missense	possibly damaging	0.78
IGL00913:Cd177	APN	7	24756195	missense	probably damaging	1.00
IGL01445:Cd177	APN	7	24752071	missense	possibly damaging	0.95
IGL02021:Cd177	APN	7	24745206	missense	probably benign	0.16
IGL02134:Cd177	APN	7	24752352	missense	probably benign	0.01
IGL02532:Cd177	APN	7	24745249	missense	probably benign	0.30
IGL02821:Cd177	APN	7	24744393	missense	probably damaging	1.00
IGL02821:Cd177	APN	7	24744394	missense	probably damaging	1.00
IGL02888:Cd177	APN	7	24758437	missense	probably damaging	0.99
R0506:Cd177	UTSW	7	24758356	missense	probably damaging	1.00
R0601:Cd177	UTSW	7	24752313	missense	probably benign	0.00
R0631:Cd177	UTSW	7	24756686	missense	probably benign	0.03
R0713:Cd177	UTSW	7	24744430	missense	probably benign	0.25
R1595:Cd177	UTSW	7	24744964	missense	probably benign
R1659:Cd177	UTSW	7	24746137	missense	probably damaging	1.00
R2258:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2260:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2379:Cd177	UTSW	7	24758043	missense	possibly damaging	0.80
R2763:Cd177	UTSW	7	24758037	missense	probably benign	0.05
R2929:Cd177	UTSW	7	24754279	nonsense	probably null
R3815:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3818:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3919:Cd177	UTSW	7	24744433	missense	probably benign	0.15
R4300:Cd177	UTSW	7	24750420	missense	possibly damaging	0.48
R4494:Cd177	UTSW	7	24752003	missense	probably benign	0.06
R4781:Cd177	UTSW	7	24750626	missense	probably damaging	1.00
R4819:Cd177	UTSW	7	24752271	missense	probably damaging	1.00
R5062:Cd177	UTSW	7	24744316	missense	probably benign	0.03
R5186:Cd177	UTSW	7	24744923	missense	probably benign	0.31
R5285:Cd177	UTSW	7	24746249	missense	probably benign	0.00
R5415:Cd177	UTSW	7	24752391	missense	probably damaging	1.00
R5577:Cd177	UTSW	7	24745137	missense	probably damaging	1.00
R5637:Cd177	UTSW	7	24756323	missense	probably benign	0.01
R5673:Cd177	UTSW	7	24750362	missense	probably damaging	1.00
R5731:Cd177	UTSW	7	24744421	missense	probably damaging	1.00
R5775:Cd177	UTSW	7	24752268	missense	probably damaging	1.00
R5840:Cd177	UTSW	7	24758070	missense	probably damaging	0.99
R5872:Cd177	UTSW	7	24752263	missense	probably null	1.00
R6148:Cd177	UTSW	7	24744273	nonsense	probably null
R6505:Cd177	UTSW	7	24744246	missense	probably benign	0.00
R6897:Cd177	UTSW	7	24745074	missense	probably benign	0.31
R7023:Cd177	UTSW	7	24759762	missense	probably benign	0.44
R7088:Cd177	UTSW	7	24745133	nonsense	probably null
R7188:Cd177	UTSW	7	24756647	missense	probably damaging	1.00
R7366:Cd177	UTSW	7	24756722	missense	probably damaging	1.00
R7744:Cd177	UTSW	7	24750375	missense	probably damaging	1.00
R8008:Cd177	UTSW	7	24752349	missense	not run
R8029:Cd177	UTSW	7	24756169	nonsense	probably null
R8030:Cd177	UTSW	7	24756169	nonsense	probably null
R8032:Cd177	UTSW	7	24756169	nonsense	probably null
R8094:Cd177	UTSW	7	24744417	missense	probably damaging	0.99
R8121:Cd177	UTSW	7	24759642	missense	probably benign
R8192:Cd177	UTSW	7	24754302	missense	probably benign	0.00
R8314:Cd177	UTSW	7	24750588	missense	probably benign	0.15
R8682:Cd177	UTSW	7	24760013	missense	possibly damaging	0.92
R8730:Cd177	UTSW	7	24758076	missense	possibly damaging	0.89
R9185:Cd177	UTSW	7	24744243	missense	probably benign	0.00
R9217:Cd177	UTSW	7	24746125	missense	possibly damaging	0.93
R9335:Cd177	UTSW	7	24744286	missense	probably benign	0.04
R9595:Cd177	UTSW	7	24752337	missense	probably damaging	1.00
R9796:Cd177	UTSW	7	24759744	missense	probably benign
Z1176:Cd177	UTSW	7	24746171	missense	probably benign	0.01
Z1177:Cd177	UTSW	7	24760256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTCCTGTATTTCCTTCAGACAG -3'
(R):5'- CTGGTATCATGAGCAGGTGC -3'

Sequencing Primer
(F):5'- CCCCTGGTACCTGTGTCAG -3'
(R):5'- GTATCATGAGCAGGTGCATCCTC -3'

Posted On

2017-02-10