Incidental Mutation 'R5870:Lrrc8e'
ID 455129
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Name leucine rich repeat containing 8 family, member E
Synonyms 1810049O03Rik, C87354
MMRRC Submission 044078-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5870 (G1)
Quality Score 219
Status Validated
Chromosome 8
Chromosomal Location 4276827-4287470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4285725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 650 (K650R)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110998] [ENSMUST00000207770] [ENSMUST00000145165] [ENSMUST00000110999]
AlphaFold Q66JT1
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000053035
AA Change: K650R

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: K650R

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,236,232 (GRCm39) V156A probably damaging Het
Ak6 C A 13: 100,791,932 (GRCm39) P125Q probably damaging Het
Aqp4 A C 18: 15,532,946 (GRCm39) V49G probably damaging Het
Arfgef1 A G 1: 10,251,163 (GRCm39) I874T probably damaging Het
Arid1a T C 4: 133,408,387 (GRCm39) D2040G unknown Het
Atp1a3 T G 7: 24,697,003 (GRCm39) D220A probably benign Het
C2cd4c A T 10: 79,448,043 (GRCm39) I368N possibly damaging Het
Ccnt1 G A 15: 98,441,394 (GRCm39) Q625* probably null Het
Cd177 T A 7: 24,455,757 (GRCm39) H255L probably benign Het
Cdipt G A 7: 126,578,094 (GRCm39) V114M probably benign Het
Coro1b T A 19: 4,199,384 (GRCm39) H14Q probably damaging Het
Ctdp1 T A 18: 80,451,901 (GRCm39) D158V unknown Het
Cts7 A T 13: 61,503,545 (GRCm39) S140T probably damaging Het
Dlgap3 T A 4: 127,089,502 (GRCm39) L366* probably null Het
Dnah9 C T 11: 65,976,036 (GRCm39) A1338T probably benign Het
Dock7 T C 4: 98,952,199 (GRCm39) I424V probably benign Het
Dock8 G T 19: 25,109,490 (GRCm39) A891S probably benign Het
Dync2i1 A G 12: 116,219,865 (GRCm39) S26P possibly damaging Het
Elmod3 A G 6: 72,571,721 (GRCm39) probably null Het
Eps15 G A 4: 109,218,507 (GRCm39) E107K probably damaging Het
Esco1 A T 18: 10,593,744 (GRCm39) probably null Het
Fuz A G 7: 44,549,742 (GRCm39) T407A probably damaging Het
Galr1 A T 18: 82,424,197 (GRCm39) F27I probably benign Het
Glt1d1 A G 5: 127,754,344 (GRCm39) Y182C probably damaging Het
Gm37240 A T 3: 84,597,828 (GRCm39) probably benign Het
Gm37610 A G 6: 41,061,848 (GRCm39) noncoding transcript Het
Gm6658 G T 8: 91,635,020 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,789 (GRCm39) T74A possibly damaging Het
Hadha G A 5: 30,349,284 (GRCm39) S109F possibly damaging Het
Herc3 A T 6: 58,893,435 (GRCm39) Q899L probably benign Het
Ift172 C T 5: 31,434,284 (GRCm39) E485K probably benign Het
Ly6d A T 15: 74,635,381 (GRCm39) V10D possibly damaging Het
Med27 A G 2: 29,279,823 (GRCm39) probably null Het
Med29 A T 7: 28,091,922 (GRCm39) V56E probably damaging Het
Mobp A G 9: 119,996,919 (GRCm39) K17E probably damaging Het
Mrpl37 G A 4: 106,923,919 (GRCm39) T25I probably benign Het
Myh1 A G 11: 67,092,805 (GRCm39) D33G possibly damaging Het
Nrg3 T A 14: 39,194,586 (GRCm39) I58F possibly damaging Het
Or52e2 A G 7: 102,804,948 (GRCm39) I2T probably benign Het
Or7e176 A G 9: 20,171,874 (GRCm39) D246G probably benign Het
Padi1 T A 4: 140,553,892 (GRCm39) D359V probably benign Het
Pcdh7 T C 5: 57,877,753 (GRCm39) V436A possibly damaging Het
Pgm3 C A 9: 86,452,414 (GRCm39) K15N probably damaging Het
Phip A T 9: 82,790,730 (GRCm39) probably benign Het
Pot1a G A 6: 25,778,950 (GRCm39) T48I possibly damaging Het
Ppic T C 18: 53,542,333 (GRCm39) K125R probably benign Het
Ppm1j T C 3: 104,692,811 (GRCm39) V440A possibly damaging Het
Prg4 T A 1: 150,331,300 (GRCm39) K458* probably null Het
Rd3 A T 1: 191,717,261 (GRCm39) M244L probably benign Het
Rflnb A G 11: 75,912,864 (GRCm39) Y175H probably benign Het
Rnf157 T A 11: 116,237,900 (GRCm39) S574C probably benign Het
Sardh A G 2: 27,110,653 (GRCm39) probably null Het
Senp3 C T 11: 69,569,048 (GRCm39) probably null Het
Siglec1 G A 2: 130,914,767 (GRCm39) R1450C probably damaging Het
Sim2 A G 16: 93,924,193 (GRCm39) H446R probably damaging Het
Spon1 T C 7: 113,631,021 (GRCm39) I444T probably damaging Het
Srebf1 T A 11: 60,094,410 (GRCm39) Q568H possibly damaging Het
Stxbp4 A T 11: 90,428,782 (GRCm39) I441N possibly damaging Het
Sugt1 G A 14: 79,846,451 (GRCm39) V163I probably benign Het
Surf1 G T 2: 26,806,271 (GRCm39) probably benign Het
Synj2 A G 17: 6,088,128 (GRCm39) E1348G probably benign Het
Tc2n A T 12: 101,619,111 (GRCm39) V349D probably damaging Het
Ten1 A G 11: 116,105,751 (GRCm39) R112G possibly damaging Het
Tm9sf4 A G 2: 153,036,201 (GRCm39) D321G probably damaging Het
Ttll12 A T 15: 83,461,237 (GRCm39) M594K probably damaging Het
Ttn T A 2: 76,703,058 (GRCm39) probably benign Het
Usp28 C T 9: 48,937,285 (GRCm39) Q185* probably null Het
Vmn2r112 A G 17: 22,838,004 (GRCm39) I822V probably benign Het
Zc3hc1 A T 6: 30,382,682 (GRCm39) L88* probably null Het
Zfr T A 15: 12,160,701 (GRCm39) V758D probably damaging Het
Zfyve27 T G 19: 42,160,110 (GRCm39) L42R probably benign Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4,285,921 (GRCm39) missense probably benign
IGL00943:Lrrc8e APN 8 4,285,658 (GRCm39) missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4,285,080 (GRCm39) missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4,284,084 (GRCm39) missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4,286,141 (GRCm39) missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4,285,392 (GRCm39) missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4,285,429 (GRCm39) missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4,285,776 (GRCm39) missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4,285,733 (GRCm39) missense probably benign
R0601:Lrrc8e UTSW 8 4,285,239 (GRCm39) splice site probably null
R1167:Lrrc8e UTSW 8 4,285,337 (GRCm39) missense probably benign
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4,284,990 (GRCm39) missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4,284,190 (GRCm39) missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4,285,202 (GRCm39) missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4,284,986 (GRCm39) nonsense probably null
R2290:Lrrc8e UTSW 8 4,281,770 (GRCm39) missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4,284,611 (GRCm39) missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4,283,981 (GRCm39) missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4,285,166 (GRCm39) missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4,284,329 (GRCm39) missense probably benign
R5516:Lrrc8e UTSW 8 4,285,818 (GRCm39) missense probably damaging 1.00
R6687:Lrrc8e UTSW 8 4,284,798 (GRCm39) missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4,286,034 (GRCm39) missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4,284,815 (GRCm39) missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4,285,626 (GRCm39) missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4,284,363 (GRCm39) missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4,284,534 (GRCm39) missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4,285,575 (GRCm39) missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4,285,140 (GRCm39) missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4,285,641 (GRCm39) missense probably damaging 1.00
R8355:Lrrc8e UTSW 8 4,284,018 (GRCm39) missense probably benign 0.02
R8487:Lrrc8e UTSW 8 4,284,218 (GRCm39) missense probably damaging 1.00
R8810:Lrrc8e UTSW 8 4,285,070 (GRCm39) missense probably benign 0.03
R8971:Lrrc8e UTSW 8 4,284,141 (GRCm39) missense probably damaging 1.00
R9088:Lrrc8e UTSW 8 4,284,410 (GRCm39) missense probably damaging 0.96
R9150:Lrrc8e UTSW 8 4,286,030 (GRCm39) missense probably benign 0.06
R9225:Lrrc8e UTSW 8 4,284,561 (GRCm39) missense probably damaging 1.00
R9255:Lrrc8e UTSW 8 4,284,504 (GRCm39) missense probably damaging 1.00
R9442:Lrrc8e UTSW 8 4,283,964 (GRCm39) missense probably benign 0.01
R9463:Lrrc8e UTSW 8 4,285,185 (GRCm39) missense probably damaging 0.99
R9475:Lrrc8e UTSW 8 4,285,346 (GRCm39) missense probably benign
Z1176:Lrrc8e UTSW 8 4,284,822 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAAGCTGGCAGTGTTACGG -3'
(R):5'- GACTCTCGAGTGCGTTGTAG -3'

Sequencing Primer
(F):5'- CAGTGTTACGGGAGCTGGAG -3'
(R):5'- CTCTCGAGTGCGTTGTAGGAGAG -3'
Posted On 2017-02-10