Incidental Mutation 'R5870:Olfr872'
ID455132
Institutional Source Beutler Lab
Gene Symbol Olfr872
Ensembl Gene ENSMUSG00000066897
Gene Nameolfactory receptor 872
SynonymsGA_x6K02T2PVTD-13999915-14000844, MOR145-3
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20237119-20261643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20260578 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 246 (D246G)
Ref Sequence ENSEMBL: ENSMUSP00000083665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086474]
Predicted Effect probably benign
Transcript: ENSMUST00000086474
AA Change: D246G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083665
Gene: ENSMUSG00000066897
AA Change: D246G

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 3.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 49 310 1.4e-9 PFAM
Pfam:7tm_1 55 304 4.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212574
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Olfr872
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01904:Olfr872 APN 9 20260290 missense probably damaging 0.99
IGL02048:Olfr872 APN 9 20260488 missense possibly damaging 0.79
IGL02232:Olfr872 APN 9 20260215 missense probably damaging 1.00
IGL02314:Olfr872 APN 9 20260478 missense probably benign 0.03
IGL03290:Olfr872 APN 9 20260260 missense probably damaging 1.00
R0410:Olfr872 UTSW 9 20260501 missense probably benign 0.03
R1482:Olfr872 UTSW 9 20260724 missense possibly damaging 0.89
R1521:Olfr872 UTSW 9 20260432 missense possibly damaging 0.91
R4930:Olfr872 UTSW 9 20260017 missense probably damaging 1.00
R5457:Olfr872 UTSW 9 20260278 missense probably damaging 1.00
R6141:Olfr872 UTSW 9 20260458 missense probably benign 0.00
R7283:Olfr872 UTSW 9 20260259 missense probably damaging 0.98
X0025:Olfr872 UTSW 9 20260486 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCTCAGGTGCACAATTTGATTG -3'
(R):5'- CTCAGGCTGTAGATGAAGGG -3'

Sequencing Primer
(F):5'- TCAATGACATGGAAATCTCTAACTTC -3'
(R):5'- GATTAAGCATAGGTGTGACCACTGTG -3'
Posted On2017-02-10