Mutagenetix > Incidental Mutation

Incidental Mutation 'R5870:Phip'

455134

Institutional Source

Beutler Lab

Gene Symbol

Phip

Ensembl Gene

ENSMUSG00000032253

Gene Name

pleckstrin homology domain interacting protein

Synonyms

Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp

MMRRC Submission

044078-MU

Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82866159-82975516 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 82908677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034787]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034787

SMART Domains

Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253

Domain	Start	End	E-Value	Type
WD40	172	211	1.5e-8	SMART
WD40	214	253	4.1e-9	SMART
WD40	256	299	3.5e-7	SMART
WD40	310	349	1.4e-1	SMART
WD40	354	393	6.6e-10	SMART
WD40	408	452	1.4e-2	SMART
WD40	455	495	3.4e-10	SMART
WD40	498	542	6.6e-2	SMART
low complexity region	802	813	N/A	INTRINSIC
low complexity region	841	854	N/A	INTRINSIC
low complexity region	865	877	N/A	INTRINSIC
coiled coil region	881	907	N/A	INTRINSIC
low complexity region	928	941	N/A	INTRINSIC
BROMO	1158	1261	3.5e-11	SMART
BROMO	1318	1423	4.1e-30	SMART
low complexity region	1438	1463	N/A	INTRINSIC
low complexity region	1500	1513	N/A	INTRINSIC
low complexity region	1708	1721	N/A	INTRINSIC
low complexity region	1752	1758	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187021

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188868

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

93% (84/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	G	16: 4,418,368	V156A	probably damaging	Het
Ak6	C	A	13: 100,655,424	P125Q	probably damaging	Het
Aqp4	A	C	18: 15,399,889	V49G	probably damaging	Het
Arfgef1	A	G	1: 10,180,938	I874T	probably damaging	Het
Arid1a	T	C	4: 133,681,076	D2040G	unknown	Het
Atp1a3	T	G	7: 24,997,578	D220A	probably benign	Het
C2cd4c	A	T	10: 79,612,209	I368N	possibly damaging	Het
Ccnt1	G	A	15: 98,543,513	Q625*	probably null	Het
Cd177	T	A	7: 24,756,332	H255L	probably benign	Het
Cdipt	G	A	7: 126,978,922	V114M	probably benign	Het
Coro1b	T	A	19: 4,149,385	H14Q	probably damaging	Het
Ctdp1	T	A	18: 80,408,686	D158V	unknown	Het
Cts7	A	T	13: 61,355,731	S140T	probably damaging	Het
Dlgap3	T	A	4: 127,195,709	L366*	probably null	Het
Dnah9	C	T	11: 66,085,210	A1338T	probably benign	Het
Dock7	T	C	4: 99,063,962	I424V	probably benign	Het
Dock8	G	T	19: 25,132,126	A891S	probably benign	Het
Elmod3	A	G	6: 72,594,738		probably null	Het
Eps15	G	A	4: 109,361,310	E107K	probably damaging	Het
Esco1	A	T	18: 10,593,744		probably null	Het
Fuz	A	G	7: 44,900,318	T407A	probably damaging	Het
Galr1	A	T	18: 82,406,072	F27I	probably benign	Het
Glt1d1	A	G	5: 127,677,280	Y182C	probably damaging	Het
Gm37240	A	T	3: 84,690,521		probably benign	Het
Gm37610	A	G	6: 41,084,914		noncoding transcript	Het
Gm6658	G	T	8: 90,908,392		probably benign	Het
Gm9376	A	G	14: 118,267,377	T74A	possibly damaging	Het
Hadha	G	A	5: 30,144,286	S109F	possibly damaging	Het
Herc3	A	T	6: 58,916,450	Q899L	probably benign	Het
Ift172	C	T	5: 31,276,940	E485K	probably benign	Het
Lrrc8e	A	G	8: 4,235,725	K650R	possibly damaging	Het
Ly6d	A	T	15: 74,763,532	V10D	possibly damaging	Het
Med27	A	G	2: 29,389,811		probably null	Het
Med29	A	T	7: 28,392,497	V56E	probably damaging	Het
Mobp	A	G	9: 120,167,853	K17E	probably damaging	Het
Mrpl37	G	A	4: 107,066,722	T25I	probably benign	Het
Myh1	A	G	11: 67,201,979	D33G	possibly damaging	Het
Nrg3	T	A	14: 39,472,629	I58F	possibly damaging	Het
Olfr589	A	G	7: 103,155,741	I2T	probably benign	Het
Olfr872	A	G	9: 20,260,578	D246G	probably benign	Het
Padi1	T	A	4: 140,826,581	D359V	probably benign	Het
Pcdh7	T	C	5: 57,720,411	V436A	possibly damaging	Het
Pgm3	C	A	9: 86,570,361	K15N	probably damaging	Het
Pot1a	G	A	6: 25,778,951	T48I	possibly damaging	Het
Ppic	T	C	18: 53,409,261	K125R	probably benign	Het
Ppm1j	T	C	3: 104,785,495	V440A	possibly damaging	Het
Prg4	T	A	1: 150,455,549	K458*	probably null	Het
Rd3	A	T	1: 191,985,300	M244L	probably benign	Het
Rflnb	A	G	11: 76,022,038	Y175H	probably benign	Het
Rnf157	T	A	11: 116,347,074	S574C	probably benign	Het
Sardh	A	G	2: 27,220,641		probably null	Het
Senp3	C	T	11: 69,678,222		probably null	Het
Siglec1	G	A	2: 131,072,847	R1450C	probably damaging	Het
Sim2	A	G	16: 94,123,334	H446R	probably damaging	Het
Spon1	T	C	7: 114,031,786	I444T	probably damaging	Het
Srebf1	T	A	11: 60,203,584	Q568H	possibly damaging	Het
Stxbp4	A	T	11: 90,537,956	I441N	possibly damaging	Het
Sugt1	G	A	14: 79,609,011	V163I	probably benign	Het
Surf1	G	T	2: 26,916,259		probably benign	Het
Synj2	A	G	17: 6,037,853	E1348G	probably benign	Het
Tc2n	A	T	12: 101,652,852	V349D	probably damaging	Het
Ten1	A	G	11: 116,214,925	R112G	possibly damaging	Het
Tm9sf4	A	G	2: 153,194,281	D321G	probably damaging	Het
Ttll12	A	T	15: 83,577,036	M594K	probably damaging	Het
Ttn	T	A	2: 76,872,714		probably benign	Het
Usp28	C	T	9: 49,025,985	Q185*	probably null	Het
Vmn2r112	A	G	17: 22,619,023	I822V	probably benign	Het
Wdr60	A	G	12: 116,256,245	S26P	possibly damaging	Het
Zc3hc1	A	T	6: 30,382,683	L88*	probably null	Het
Zfr	T	A	15: 12,160,615	V758D	probably damaging	Het
Zfyve27	T	G	19: 42,171,671	L42R	probably benign	Het

Other mutations in Phip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Phip	APN	9	82871303	missense	probably damaging	0.99
IGL01510:Phip	APN	9	82913871	missense	probably benign	0.01
IGL01916:Phip	APN	9	82890469	missense	possibly damaging	0.61
IGL02068:Phip	APN	9	82945808	missense	probably damaging	1.00
IGL02089:Phip	APN	9	82871319	missense	probably damaging	1.00
IGL02121:Phip	APN	9	82893370	missense	probably damaging	1.00
IGL02132:Phip	APN	9	82881341	missense	possibly damaging	0.91
IGL02146:Phip	APN	9	82881718	missense	probably benign	0.05
IGL02282:Phip	APN	9	82913690	missense	probably benign	0.09
IGL02341:Phip	APN	9	82932883	missense	probably damaging	1.00
IGL02342:Phip	APN	9	82886692	missense	probably damaging	1.00
IGL02470:Phip	APN	9	82890454	missense	possibly damaging	0.69
IGL02585:Phip	APN	9	82903188	missense	probably benign	0.03
IGL03271:Phip	APN	9	82884824	splice site	probably benign
3-1:Phip	UTSW	9	82886671	missense	probably damaging	1.00
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0137:Phip	UTSW	9	82927191	splice site	probably null
R0268:Phip	UTSW	9	82871288	missense	probably damaging	1.00
R0366:Phip	UTSW	9	82926407	missense	probably damaging	1.00
R0421:Phip	UTSW	9	82926457	missense	probably damaging	1.00
R0481:Phip	UTSW	9	82876716	splice site	probably benign
R0883:Phip	UTSW	9	82876221	missense	probably benign	0.01
R0885:Phip	UTSW	9	82875395	missense	probably benign	0.06
R1300:Phip	UTSW	9	82876747	missense	probably benign	0.00
R1434:Phip	UTSW	9	82959605	missense	probably damaging	0.99
R1448:Phip	UTSW	9	82915423	missense	possibly damaging	0.92
R1588:Phip	UTSW	9	82900828	missense	probably damaging	1.00
R1619:Phip	UTSW	9	82871449	missense	probably benign	0.20
R1658:Phip	UTSW	9	82871498	missense	probably benign
R1688:Phip	UTSW	9	82871657	missense	probably benign
R1773:Phip	UTSW	9	82876189	missense	probably benign
R1865:Phip	UTSW	9	82945792	missense	probably damaging	1.00
R1934:Phip	UTSW	9	82903182	missense	probably benign	0.11
R2070:Phip	UTSW	9	82875299	missense	probably benign
R2096:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2097:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2099:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2192:Phip	UTSW	9	82871815	missense	probably damaging	0.99
R2402:Phip	UTSW	9	82875305	missense	probably benign
R2447:Phip	UTSW	9	82915399	missense	probably damaging	0.99
R2504:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2507:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2508:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R3706:Phip	UTSW	9	82900743	missense	probably benign	0.02
R3829:Phip	UTSW	9	82871645	missense	probably benign
R3846:Phip	UTSW	9	82876126	nonsense	probably null
R4301:Phip	UTSW	9	82959713	nonsense	probably null
R4366:Phip	UTSW	9	82900869	intron	probably benign
R4748:Phip	UTSW	9	82908869	missense	probably benign	0.01
R4895:Phip	UTSW	9	82959595	missense	probably benign	0.20
R5001:Phip	UTSW	9	82896019	splice site	probably null
R5094:Phip	UTSW	9	82871844	missense	probably benign
R5181:Phip	UTSW	9	82871190	utr 3 prime	probably benign
R5194:Phip	UTSW	9	82908862	missense	probably benign	0.03
R5291:Phip	UTSW	9	82945883	missense	probably damaging	1.00
R5335:Phip	UTSW	9	82900756	missense	possibly damaging	0.93
R5458:Phip	UTSW	9	82926500	missense	probably benign	0.40
R5704:Phip	UTSW	9	82871355	missense	probably damaging	0.97
R5866:Phip	UTSW	9	82890150	missense	probably benign
R5890:Phip	UTSW	9	82906952	missense	probably benign	0.00
R6232:Phip	UTSW	9	82903181	missense	probably benign
R6379:Phip	UTSW	9	82913857	missense	probably damaging	0.98
R6653:Phip	UTSW	9	82900741	nonsense	probably null
R7129:Phip	UTSW	9	82877300	missense	probably damaging	0.98
R7290:Phip	UTSW	9	82871293	missense	possibly damaging	0.94
R7598:Phip	UTSW	9	82905658	missense	possibly damaging	0.94
R7632:Phip	UTSW	9	82903190	missense	probably benign
R7752:Phip	UTSW	9	82890150	missense	probably benign
R7827:Phip	UTSW	9	82908833	missense	probably benign
R7901:Phip	UTSW	9	82890150	missense	probably benign
R7960:Phip	UTSW	9	82893348	missense	probably benign	0.00
R8006:Phip	UTSW	9	82890126	missense	possibly damaging	0.93
R8066:Phip	UTSW	9	82875298	missense	probably benign	0.05
R8080:Phip	UTSW	9	82887609	missense	probably damaging	1.00
R8135:Phip	UTSW	9	82930374	missense	probably benign	0.09
R8347:Phip	UTSW	9	82908763	missense	probably benign	0.02
R8459:Phip	UTSW	9	82876053	missense	probably benign
R8705:Phip	UTSW	9	82893559	missense	probably damaging	0.99
R8706:Phip	UTSW	9	82905712	missense	possibly damaging	0.89
R8743:Phip	UTSW	9	82927087	missense	probably benign	0.18
R8801:Phip	UTSW	9	82876252	missense	probably benign	0.22
R8930:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8932:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8969:Phip	UTSW	9	82926964	intron	probably benign
R9064:Phip	UTSW	9	82871487	missense	probably benign	0.20
R9332:Phip	UTSW	9	82875359	missense	probably damaging	0.98
R9335:Phip	UTSW	9	82932926	missense	probably benign	0.03
R9520:Phip	UTSW	9	82871384	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGAACCTAATTTGTGACACACCC -3'
(R):5'- GAACTTAATCACCCTGATTTTCGC -3'

Sequencing Primer
(F):5'- ACCTAATTTGTGACACACCCCTATC -3'
(R):5'- GGCTCAGTAAGTTCTACCTCCGAAG -3'

Posted On

2017-02-10