Incidental Mutation 'R5870:Pgm3'
ID455135
Institutional Source Beutler Lab
Gene Symbol Pgm3
Ensembl Gene ENSMUSG00000056131
Gene Namephosphoglucomutase 3
SynonymsPgm-3, GlcNAc-P mutase, 2810473H05Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86554377-86571842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86570361 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 15 (K15N)
Ref Sequence ENSEMBL: ENSMUSP00000072390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034988] [ENSMUST00000070064] [ENSMUST00000072585] [ENSMUST00000179212] [ENSMUST00000185566]
Predicted Effect probably benign
Transcript: ENSMUST00000034988
SMART Domains Protein: ENSMUSP00000034988
Gene: ENSMUSG00000032417

DomainStartEndE-ValueType
RWD 14 134 1.22e-25 SMART
Pfam:DUF1115 160 283 7.7e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070064
AA Change: K15N

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070871
Gene: ENSMUSG00000056131
AA Change: K15N

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 6.5e-9 PFAM
Pfam:PGM_PMM_I 96 174 4.3e-9 PFAM
Pfam:PGM_PMM_IV 443 528 8.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072585
AA Change: K15N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072390
Gene: ENSMUSG00000056131
AA Change: K15N

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 2.5e-10 PFAM
Pfam:PGM_PMM_I 95 175 3.6e-11 PFAM
Pfam:PGM_PMM_II 181 291 9.4e-14 PFAM
SCOP:d3pmga3 298 374 1e-8 SMART
Pfam:PGM_PMM_IV 383 487 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179212
SMART Domains Protein: ENSMUSP00000137392
Gene: ENSMUSG00000032417

DomainStartEndE-ValueType
RWD 14 134 1.22e-25 SMART
Pfam:DUF1115 158 282 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185566
SMART Domains Protein: ENSMUSP00000139930
Gene: ENSMUSG00000032417

DomainStartEndE-ValueType
RWD 14 134 1.22e-25 SMART
Pfam:DUF1115 160 283 7.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187251
Meta Mutation Damage Score 0.4075 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility, anemia, leukopenia, thrombocytopenia, abnormal pancreatic and salivary gland morphology, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Pgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Pgm3 APN 9 86561879 missense probably damaging 0.96
IGL01865:Pgm3 APN 9 86555318 missense possibly damaging 0.85
IGL02800:Pgm3 APN 9 86555378 missense possibly damaging 0.94
R6592_Pgm3_648 UTSW 9 86559443 missense possibly damaging 0.87
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0266:Pgm3 UTSW 9 86567533 missense probably benign 0.00
R0536:Pgm3 UTSW 9 86567536 missense possibly damaging 0.83
R0617:Pgm3 UTSW 9 86556190 critical splice donor site probably null
R1499:Pgm3 UTSW 9 86570287 missense probably benign 0.01
R1780:Pgm3 UTSW 9 86556204 missense probably damaging 1.00
R1838:Pgm3 UTSW 9 86569233 missense probably benign 0.03
R1882:Pgm3 UTSW 9 86565690 missense possibly damaging 0.72
R1920:Pgm3 UTSW 9 86558478 missense possibly damaging 0.47
R2095:Pgm3 UTSW 9 86556341 missense probably damaging 0.99
R2378:Pgm3 UTSW 9 86562667 missense probably damaging 0.97
R2679:Pgm3 UTSW 9 86569321 missense probably benign 0.32
R3021:Pgm3 UTSW 9 86567535 missense possibly damaging 0.95
R3686:Pgm3 UTSW 9 86559510 missense probably benign 0.37
R4490:Pgm3 UTSW 9 86561840 missense probably damaging 1.00
R4651:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4652:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4718:Pgm3 UTSW 9 86570395 missense probably benign 0.00
R4883:Pgm3 UTSW 9 86569325 missense probably damaging 1.00
R4940:Pgm3 UTSW 9 86559476 missense probably damaging 1.00
R4973:Pgm3 UTSW 9 86562679 missense probably benign
R4990:Pgm3 UTSW 9 86558412 missense probably damaging 0.97
R5357:Pgm3 UTSW 9 86556257 nonsense probably null
R6592:Pgm3 UTSW 9 86559443 missense possibly damaging 0.87
R6807:Pgm3 UTSW 9 86556502 splice site probably null
R7152:Pgm3 UTSW 9 86567540 missense probably benign 0.13
R7274:Pgm3 UTSW 9 86562597 missense probably damaging 1.00
R8112:Pgm3 UTSW 9 86564775 missense probably benign
R8195:Pgm3 UTSW 9 86570321 missense probably damaging 1.00
X0028:Pgm3 UTSW 9 86569355 missense probably damaging 1.00
Z1088:Pgm3 UTSW 9 86564707 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGTGGACTTCAGTTCAAGATTCTTAG -3'
(R):5'- TCCCTGCCTTCCCAAAAGTG -3'

Sequencing Primer
(F):5'- GTCTTGTAAATAAAGACAGCACCTTG -3'
(R):5'- CCCAAAAGTGGTTCTCTGGAG -3'
Posted On2017-02-10