Mutagenetix > Incidental Mutation

Incidental Mutation 'R5870:Wdr60'

455147

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

044078-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116256245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 26 (S26P)

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]

AlphaFold

Q8C761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039349
AA Change: S26P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: S26P

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221029

Predicted Effect

probably benign
Transcript: ENSMUST00000222679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223039

Meta Mutation Damage Score

0.1106

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

93% (84/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	G	16: 4,418,368	V156A	probably damaging	Het
Ak6	C	A	13: 100,655,424	P125Q	probably damaging	Het
Aqp4	A	C	18: 15,399,889	V49G	probably damaging	Het
Arfgef1	A	G	1: 10,180,938	I874T	probably damaging	Het
Arid1a	T	C	4: 133,681,076	D2040G	unknown	Het
Atp1a3	T	G	7: 24,997,578	D220A	probably benign	Het
C2cd4c	A	T	10: 79,612,209	I368N	possibly damaging	Het
Ccnt1	G	A	15: 98,543,513	Q625*	probably null	Het
Cd177	T	A	7: 24,756,332	H255L	probably benign	Het
Cdipt	G	A	7: 126,978,922	V114M	probably benign	Het
Coro1b	T	A	19: 4,149,385	H14Q	probably damaging	Het
Ctdp1	T	A	18: 80,408,686	D158V	unknown	Het
Cts7	A	T	13: 61,355,731	S140T	probably damaging	Het
Dlgap3	T	A	4: 127,195,709	L366*	probably null	Het
Dnah9	C	T	11: 66,085,210	A1338T	probably benign	Het
Dock7	T	C	4: 99,063,962	I424V	probably benign	Het
Dock8	G	T	19: 25,132,126	A891S	probably benign	Het
Elmod3	A	G	6: 72,594,738		probably null	Het
Eps15	G	A	4: 109,361,310	E107K	probably damaging	Het
Esco1	A	T	18: 10,593,744		probably null	Het
Fuz	A	G	7: 44,900,318	T407A	probably damaging	Het
Galr1	A	T	18: 82,406,072	F27I	probably benign	Het
Glt1d1	A	G	5: 127,677,280	Y182C	probably damaging	Het
Gm37240	A	T	3: 84,690,521		probably benign	Het
Gm37610	A	G	6: 41,084,914		noncoding transcript	Het
Gm6658	G	T	8: 90,908,392		probably benign	Het
Gm9376	A	G	14: 118,267,377	T74A	possibly damaging	Het
Hadha	G	A	5: 30,144,286	S109F	possibly damaging	Het
Herc3	A	T	6: 58,916,450	Q899L	probably benign	Het
Ift172	C	T	5: 31,276,940	E485K	probably benign	Het
Lrrc8e	A	G	8: 4,235,725	K650R	possibly damaging	Het
Ly6d	A	T	15: 74,763,532	V10D	possibly damaging	Het
Med27	A	G	2: 29,389,811		probably null	Het
Med29	A	T	7: 28,392,497	V56E	probably damaging	Het
Mobp	A	G	9: 120,167,853	K17E	probably damaging	Het
Mrpl37	G	A	4: 107,066,722	T25I	probably benign	Het
Myh1	A	G	11: 67,201,979	D33G	possibly damaging	Het
Nrg3	T	A	14: 39,472,629	I58F	possibly damaging	Het
Olfr589	A	G	7: 103,155,741	I2T	probably benign	Het
Olfr872	A	G	9: 20,260,578	D246G	probably benign	Het
Padi1	T	A	4: 140,826,581	D359V	probably benign	Het
Pcdh7	T	C	5: 57,720,411	V436A	possibly damaging	Het
Pgm3	C	A	9: 86,570,361	K15N	probably damaging	Het
Phip	A	T	9: 82,908,677		probably benign	Het
Pot1a	G	A	6: 25,778,951	T48I	possibly damaging	Het
Ppic	T	C	18: 53,409,261	K125R	probably benign	Het
Ppm1j	T	C	3: 104,785,495	V440A	possibly damaging	Het
Prg4	T	A	1: 150,455,549	K458*	probably null	Het
Rd3	A	T	1: 191,985,300	M244L	probably benign	Het
Rflnb	A	G	11: 76,022,038	Y175H	probably benign	Het
Rnf157	T	A	11: 116,347,074	S574C	probably benign	Het
Sardh	A	G	2: 27,220,641		probably null	Het
Senp3	C	T	11: 69,678,222		probably null	Het
Siglec1	G	A	2: 131,072,847	R1450C	probably damaging	Het
Sim2	A	G	16: 94,123,334	H446R	probably damaging	Het
Spon1	T	C	7: 114,031,786	I444T	probably damaging	Het
Srebf1	T	A	11: 60,203,584	Q568H	possibly damaging	Het
Stxbp4	A	T	11: 90,537,956	I441N	possibly damaging	Het
Sugt1	G	A	14: 79,609,011	V163I	probably benign	Het
Surf1	G	T	2: 26,916,259		probably benign	Het
Synj2	A	G	17: 6,037,853	E1348G	probably benign	Het
Tc2n	A	T	12: 101,652,852	V349D	probably damaging	Het
Ten1	A	G	11: 116,214,925	R112G	possibly damaging	Het
Tm9sf4	A	G	2: 153,194,281	D321G	probably damaging	Het
Ttll12	A	T	15: 83,577,036	M594K	probably damaging	Het
Ttn	T	A	2: 76,872,714		probably benign	Het
Usp28	C	T	9: 49,025,985	Q185*	probably null	Het
Vmn2r112	A	G	17: 22,619,023	I822V	probably benign	Het
Zc3hc1	A	T	6: 30,382,683	L88*	probably null	Het
Zfr	T	A	15: 12,160,615	V758D	probably damaging	Het
Zfyve27	T	G	19: 42,171,671	L42R	probably benign	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1023:Wdr60	UTSW	12	116232657	missense	probably damaging	1.00
R1065:Wdr60	UTSW	12	116256076	missense	probably damaging	0.98
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R2444:Wdr60	UTSW	12	116232669	missense	possibly damaging	0.93
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6364:Wdr60	UTSW	12	116241732	missense	probably damaging	1.00
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
R9751:Wdr60	UTSW	12	116241783	critical splice acceptor site	probably null
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACGAGGATGTTCTGTGGAG -3'
(R):5'- TGCCAATCAGCTCGTACATG -3'

Sequencing Primer
(F):5'- AGGTGTACAGGTCTCTCTCAGC -3'
(R):5'- CCAATCAGCTCGTACATGGGTTTG -3'

Posted On

2017-02-10