Incidental Mutation 'R5870:Nrg3'
ID455150
Institutional Source Beutler Lab
Gene Symbol Nrg3
Ensembl Gene ENSMUSG00000041014
Gene Nameneuregulin 3
Synonymsska
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5870 (G1)
Quality Score142
Status Not validated
Chromosome14
Chromosomal Location38368952-39473088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39472629 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 58 (I58F)
Ref Sequence ENSEMBL: ENSMUSP00000134727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166968] [ENSMUST00000168810] [ENSMUST00000173780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166968
AA Change: I58F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136884
Gene: ENSMUSG00000041014
AA Change: I58F

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
Pfam:Neuregulin 355 480 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168810
AA Change: I58F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129783
Gene: ENSMUSG00000041014
AA Change: I58F

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173780
AA Change: I58F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134727
Gene: ENSMUSG00000041014
AA Change: I58F

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mutations in this gene result in abnormal, genetic background specific, mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Nrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Nrg3 APN 14 38370801 missense probably damaging 0.99
IGL01994:Nrg3 APN 14 39012086 missense probably damaging 1.00
IGL02002:Nrg3 APN 14 38370767 nonsense probably null
IGL02247:Nrg3 APN 14 38371312 missense probably damaging 0.98
IGL02967:Nrg3 APN 14 38668299 splice site probably benign
R6803_Nrg3_459 UTSW 14 39012000 nonsense probably null
FR4304:Nrg3 UTSW 14 38397273 small insertion probably benign
FR4449:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4548:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4589:Nrg3 UTSW 14 38397266 small insertion probably benign
R0178:Nrg3 UTSW 14 38376456 missense probably damaging 1.00
R0825:Nrg3 UTSW 14 39472391 missense possibly damaging 0.67
R1545:Nrg3 UTSW 14 38407154 missense probably benign 0.03
R2009:Nrg3 UTSW 14 38370814 missense probably damaging 0.99
R2022:Nrg3 UTSW 14 38376352 missense probably damaging 0.98
R2264:Nrg3 UTSW 14 38381702 missense probably damaging 1.00
R2937:Nrg3 UTSW 14 38371008 missense possibly damaging 0.94
R2958:Nrg3 UTSW 14 39472712 missense unknown
R3085:Nrg3 UTSW 14 38370949 missense probably damaging 0.99
R3801:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R3803:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R4246:Nrg3 UTSW 14 39472241 missense possibly damaging 0.58
R5584:Nrg3 UTSW 14 39472697 small deletion probably benign
R5625:Nrg3 UTSW 14 38370993 missense probably damaging 0.99
R6007:Nrg3 UTSW 14 39472452 nonsense probably null
R6047:Nrg3 UTSW 14 38397352 critical splice acceptor site probably null
R6294:Nrg3 UTSW 14 38397239 missense probably benign 0.00
R6803:Nrg3 UTSW 14 39012000 nonsense probably null
R7023:Nrg3 UTSW 14 38376376 missense probably damaging 1.00
R7159:Nrg3 UTSW 14 38370735 nonsense probably null
R7194:Nrg3 UTSW 14 39472478 missense probably benign 0.17
R7297:Nrg3 UTSW 14 38370939 missense probably benign 0.10
R7413:Nrg3 UTSW 14 38370712 missense probably damaging 0.99
R7474:Nrg3 UTSW 14 39011999 missense probably damaging 0.98
R7684:Nrg3 UTSW 14 39472565 missense probably damaging 1.00
R7848:Nrg3 UTSW 14 38668283 missense probably damaging 1.00
R8342:Nrg3 UTSW 14 39012096 missense probably damaging 1.00
R8435:Nrg3 UTSW 14 39472697 small deletion probably benign
X0020:Nrg3 UTSW 14 38397241 missense probably benign 0.01
Z1176:Nrg3 UTSW 14 39472533 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCATAGCCTTGGGGAAAGAG -3'
(R):5'- AAGGTGAAGATCGGCTCCTAGG -3'

Sequencing Primer
(F):5'- CCTTGGGGAAAGAGCTGGG -3'
(R):5'- AGATCGGCTCCTAGGATGAGTG -3'
Posted On2017-02-10